View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5390_high_13 (Length: 256)
Name: NF5390_high_13
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5390_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 29441257 - 29441342
Alignment:
| Q |
7 |
ctttgcaaataacagccgcaaaa-aacatttgcaaattaggcaccgaaaacttgctaccattgccggttagaaacacaactttgct |
91 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
29441257 |
ctttgcaaataacagtcacaaaaaaacatttgcaaattaggcaccgaaaacctgctaccattgccggttagaaacacgactttgct |
29441342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 29441345 - 29441393
Alignment:
| Q |
123 |
taactttaacaactaaatttcaatcacaacaaattagaaaataccacaa |
171 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
29441345 |
taactttaactactaaatttcaatcacaataaatcagaaaataccacaa |
29441393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University