View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5390_low_10 (Length: 303)
Name: NF5390_low_10
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5390_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 186 - 292
Target Start/End: Original strand, 40056834 - 40056940
Alignment:
| Q |
186 |
tgtggattctaatgagtgtgttgaaggtgaatgttgttgggtttggaattgaattgaagagggaaagtgcataggttgttagaaatgaattggaataagt |
285 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40056834 |
tgtggattctgatgagtgtgttgaaggtgaatgttgttgggtttggaattgaattgaagagggaaagtgcataggttgttagaaatgaattggaataagt |
40056933 |
T |
 |
| Q |
286 |
tttgatg |
292 |
Q |
| |
|
||||||| |
|
|
| T |
40056934 |
tttgatg |
40056940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 40056649 - 40056762
Alignment:
| Q |
1 |
aacaaaagaatcaaccagaaatccatacttgaaaactggggagtgaagagactgagcaagagaaagagagtgtagttgagaagaggctttgaggataaga |
100 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40056649 |
aacaaaagagtcaaccagaaaaccatacttgaaaacttgggagtgaagagactgagcaagagaaagagagtgtagttgagaagaggctttgaggatcaga |
40056748 |
T |
 |
| Q |
101 |
gggaaagtgtggaa |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40056749 |
gggaaagtgtggaa |
40056762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University