View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5390_low_13 (Length: 256)

Name: NF5390_low_13
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5390_low_13
NF5390_low_13
[»] chr8 (2 HSPs)
chr8 (7-91)||(29441257-29441342)
chr8 (123-171)||(29441345-29441393)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 29441257 - 29441342
Alignment:
7 ctttgcaaataacagccgcaaaa-aacatttgcaaattaggcaccgaaaacttgctaccattgccggttagaaacacaactttgct 91  Q
    ||||||||||||||| | ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
29441257 ctttgcaaataacagtcacaaaaaaacatttgcaaattaggcaccgaaaacctgctaccattgccggttagaaacacgactttgct 29441342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 29441345 - 29441393
Alignment:
123 taactttaacaactaaatttcaatcacaacaaattagaaaataccacaa 171  Q
    |||||||||| |||||||||||||||||| |||| ||||||||||||||    
29441345 taactttaactactaaatttcaatcacaataaatcagaaaataccacaa 29441393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University