View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5390_low_16 (Length: 239)
Name: NF5390_low_16
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5390_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 35796967 - 35797168
Alignment:
| Q |
19 |
aatgaaatagacaaacaatgagttatttaaattattcagttgtaggaaacttcaattggagcttcttaaaatgttgtaaaatgcgtagaatccaaatcaa |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35796967 |
aatgaaatagacaaacaacgagttatttaaattatttagttgtaggaaacttcaattggagcttcttaaaatgttgtaaaatgcgtagaatccaaatcaa |
35797066 |
T |
|
| Q |
119 |
gtctaaactagaaagaggcaattgaacccttatctcaaatacttactttatgttagaaagcttttcacttgtattccaggcaaaatttcatatcttcttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35797067 |
gtctaaactagaaagaggcaattgaacccttatctcaaatacttactttatgttagaaagcttttcaattgtattccaggcaaaatttcatatcttcttt |
35797166 |
T |
|
| Q |
219 |
ct |
220 |
Q |
| |
|
|| |
|
|
| T |
35797167 |
ct |
35797168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University