View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5390_low_18 (Length: 224)
Name: NF5390_low_18
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5390_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 9746448 - 9746549
Alignment:
| Q |
1 |
caaattcagtctgctcagaatcaacaagatcatacgaaggtgaagggcaattcaatagaccaagtgtccccgaatttatcagtagagattcaaggagtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9746448 |
caaattcagtctgctcagaatcaacaagatcatacgaaggtgaagggaaattcaatggaccaagtttccccgaatttatcagtagagattcaaggagtta |
9746547 |
T |
 |
| Q |
101 |
ct |
102 |
Q |
| |
|
|| |
|
|
| T |
9746548 |
ct |
9746549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University