View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5391_low_1 (Length: 278)
Name: NF5391_low_1
Description: NF5391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5391_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 10647692 - 10647442
Alignment:
| Q |
10 |
catcatcattcagatccatcacatagaaaaaattaggactccccagttgacggtggcagaagtaatttgaaataagttctgcatcaccnnnnnnnagctt |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10647692 |
catcatcattcagatccatcaaatagaaaaaattaggactccccagttgacggtggcagaagtaatttgaaacaagttctgcatcacctttttttagctt |
10647593 |
T |
 |
| Q |
110 |
cagtctcctggaaaatttaacgttggtgctagttcctccttcattagaatttgagctcccataaccggaaacatctacagttggcattcgatataacttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10647592 |
cagtctcctggaaaatttaacgttggtgctagttcctccttcattagaatttgagctcccataaccggaaacatctacagttggcattcgatataacttg |
10647493 |
T |
 |
| Q |
210 |
attgtccgtactgcgacatctagagtcggctcaacctttcttttggcccca |
260 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10647492 |
attgtccgtacagcaacatctagagtcggctcaacctttcttttggcccca |
10647442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University