View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5392_high_3 (Length: 290)

Name: NF5392_high_3
Description: NF5392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5392_high_3
NF5392_high_3
[»] chr1 (1 HSPs)
chr1 (15-271)||(51742752-51743008)


Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 271
Target Start/End: Original strand, 51742752 - 51743008
Alignment:
15 gagaggatgaagatatgagacgaaggagacgcgatctgttacgtcatcgaattagggatttggcgacccgaacccgaagcatgcagaatcggatcttgga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51742752 gagaggatgaagatatgagacgaaggagacgcgatctgttacgtcatcgaattagggatttggcgacccgaacccgaagcatgcagaatcggatcttgga 51742851  T
115 ttgggctgaaattttgatgggacttgaagataattcgattgagtttcgtcttcaggcaccagaattggaccggtacgttggtaatccggaggattatgtt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51742852 ttgggctgaaattttgatgggacttgaagataattcgattgagtttcgtcttcaggcaccagaattggaccggtacgttggtaatccggaggattatgtt 51742951  T
215 gatgcggcggagtatgaggcgttgctgcagacgttggcggagaatgatggaaatggg 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51742952 gatgcggcggagtatgaggcgttgctgcagacgttggcggagaatgatggaaatggg 51743008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University