View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5392_high_6 (Length: 256)
Name: NF5392_high_6
Description: NF5392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5392_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 17 - 162
Target Start/End: Original strand, 12238844 - 12238989
Alignment:
| Q |
17 |
agtttgctgcgaaacggaaggtggtgtctgagtgtgaacggcggtggtgggtcccacgtgatggtggcatggtttctaagtcaattatgactggtggtgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12238844 |
agtttgctgcgaaacggaaggtggtgtctgagtgtgaacggcggtggtgggtcccacgtgatggtggcatggtttctaagtcaattatgactggtggtgg |
12238943 |
T |
 |
| Q |
117 |
ttttcttgtgaagttgttttgttccattgaaactaaaaataatgat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12238944 |
ttttcttgtgaagttgttttgttccattgaaactaaaaataatgat |
12238989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University