View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5392_low_8 (Length: 213)
Name: NF5392_low_8
Description: NF5392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5392_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 35 - 196
Target Start/End: Complemental strand, 11109516 - 11109355
Alignment:
| Q |
35 |
aatactacagcaaagcataataatagaaacatacttgaacgaaacaatcatgaaaatgatgcctgatgatactggcaggcattcggggatccgtcttagc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109516 |
aatactacagcaaagcataataatagaaacatacttgaacgaaacaatcatgaaaatgaagcctgatgatactggcaggcattcggggatccgtcttagc |
11109417 |
T |
|
| Q |
135 |
aactttccgcaagactttaaatgctataaaatgcaattggggacaagttttgccataaaagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
11109416 |
aactttccgcaagactttaaatgctatagaatgcaatttgggacaagttttgccataaaagt |
11109355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 196
Target Start/End: Complemental strand, 11117952 - 11117819
Alignment:
| Q |
63 |
acatacttgaacgaaacaatcatgaaaatgatgcctgatgatactggcaggcattcggggatccgtcttagcaactttccgcaagactttaaatgctata |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| |||||||| ||||||||||| | ||| ||||||| ||| ||| |||| || ||| | ||| |
|
|
| T |
11117952 |
acatacttgaacgaaacaatcatgaaagtgaagcctaatgatactcgcaggcattcgagaatcagtcttagaaaccttctctaagatttgaaacacaata |
11117853 |
T |
|
| Q |
163 |
aaatgcaattggggacaagttttgccataaaagt |
196 |
Q |
| |
|
| |||||||||||||| |||||| | ||||||| |
|
|
| T |
11117852 |
gattgcaattggggacatgttttggcgtaaaagt |
11117819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 11103504 - 11103455
Alignment:
| Q |
62 |
aacatacttgaacgaaacaatcatgaaaatgatgcctgatgatactggca |
111 |
Q |
| |
|
||||||||||||| || ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11103504 |
aacatacttgaacaaagcaatcatgaaaatgaagcctgatgagactggca |
11103455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 66 - 122
Target Start/End: Original strand, 10794285 - 10794341
Alignment:
| Q |
66 |
tacttgaacgaaacaatcatgaaaatgatgcctgatgatactggcaggcattcgggg |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| | | | |||||||||||||| |
|
|
| T |
10794285 |
tacttgaacgaaacaatcatgaaagtgaagcctgattagaatcgcaggcattcgggg |
10794341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 11192280 - 11192328
Alignment:
| Q |
63 |
acatacttgaacgaaacaatcatgaaaatgatgcctgatgatactggca |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| |||| ||||||| |
|
|
| T |
11192280 |
acatacttgaacaaaacaatcatgaaaatgaagcctaatgaaactggca |
11192328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University