View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5392_low_9 (Length: 206)
Name: NF5392_low_9
Description: NF5392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5392_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 22 - 185
Target Start/End: Original strand, 12156728 - 12156891
Alignment:
| Q |
22 |
atgatgcactacgaaccttctttcaacattgattttgaaacatcacaacaagaactaaaacaaatttgagtagtggttaattcctcctttaagggagaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12156728 |
atgatgcactacgaaccttctttcaacattaattttgaaacatcacaacaagaactaaaacaaatttgagtagtggttaattcctcctttaggggagaat |
12156827 |
T |
 |
| Q |
122 |
taaatataggctcatcaaccagaacagtaacgaaaatccaagaacgatccttcagtgtgttatt |
185 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
12156828 |
taaatataggctcatcaactagaacattaacgaaaattcaagaacgatcctacagtgtgttatt |
12156891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University