View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5393-Insertion-1 (Length: 168)
Name: NF5393-Insertion-1
Description: NF5393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5393-Insertion-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 7 - 155
Target Start/End: Original strand, 3034071 - 3034219
Alignment:
| Q |
7 |
actaaccttcggaataaaataaatgtatgtcgaattaatctttgcaatatcctccggtgtattccagattttcgaatgaagtcagacacatttcttccaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3034071 |
actaaccttcggaataaaataaatgtatgtcgaattaatctttgcaatatcctccggtgtattccagattttcgaatgaagtcagacacatttcttccaa |
3034170 |
T |
 |
| Q |
107 |
ctatgttccacaaattttgatagaaaacccgccggaaaagccatccaga |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3034171 |
ctatgttccacaaattttgatagaaaacccgccggaaaagccatccaga |
3034219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University