View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5393-Insertion-10 (Length: 198)
Name: NF5393-Insertion-10
Description: NF5393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5393-Insertion-10 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 1e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 30519262 - 30519185
Alignment:
| Q |
121 |
agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcataca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30519262 |
agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcataca |
30519185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 30519373 - 30519341
Alignment:
| Q |
7 |
atatatgtatagtgtagttccttactatttagt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30519373 |
atatatgtatagtgtagttccttactatttagt |
30519341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University