View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5393-Insertion-10 (Length: 198)

Name: NF5393-Insertion-10
Description: NF5393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5393-Insertion-10
NF5393-Insertion-10
[»] chr4 (2 HSPs)
chr4 (121-198)||(30519185-30519262)
chr4 (7-39)||(30519341-30519373)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 1e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 30519262 - 30519185
Alignment:
121 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcataca 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30519262 agcaagaacaaattatgggataatcattccaaatggagatcaactttcttccaacctcatcatatgtgtcatcataca 30519185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 30519373 - 30519341
Alignment:
7 atatatgtatagtgtagttccttactatttagt 39  Q
    |||||||||||||||||||||||||||||||||    
30519373 atatatgtatagtgtagttccttactatttagt 30519341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University