View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5393-Insertion-11 (Length: 154)
Name: NF5393-Insertion-11
Description: NF5393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5393-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 38414813 - 38414725
Alignment:
| Q |
8 |
ataaatggagaggatcttaatc-ctcacacatgacgcgcatataaactcacgtcatgcacttagaacttgacaatcgactctcttaaaa |
95 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38414813 |
ataaatggagaggatcttaacctctcacacatgacgcgcatacgaactcacgtcacacacttagaacttgacaatcgactctcttaaaa |
38414725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University