View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5394-Insertion-5 (Length: 183)
Name: NF5394-Insertion-5
Description: NF5394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5394-Insertion-5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 4e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 4e-92
Query Start/End: Original strand, 8 - 178
Target Start/End: Original strand, 45104842 - 45105012
Alignment:
| Q |
8 |
ctttctgttaatgctcctgcttatgacttggttctgaagtttcttcttcctctcgccattcccttgcttctctttagggctgatcttcgacgagttataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45104842 |
ctttctgttaatgctcctgcttatgacttggttctgaagtttcttcttcctctcgccattcccttgcttctctttagggctgatcttcgacgagttataa |
45104941 |
T |
 |
| Q |
108 |
gttccactggcacacttctcttgcctttcttgcttggttctggtaactcacttctctcctttttcttttca |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45104942 |
gttccactggcacacttctcttgcctttcttgcttggttctggtaactcacttctctcctttttcttttca |
45105012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University