View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5394-Insertion-6 (Length: 80)
Name: NF5394-Insertion-6
Description: NF5394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5394-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 28435429 - 28435357
Alignment:
| Q |
8 |
tggtcgaatatgcacaactacgtaaggatcagacttcccaatcatttccatattctttagatcatttgctttc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28435429 |
tggtcgaatatgcacaactacgtaaggatcagacttcccaatcatttccatgttctttagatcatttgctttc |
28435357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University