View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5395_high_2 (Length: 404)
Name: NF5395_high_2
Description: NF5395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5395_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 224 - 396
Target Start/End: Complemental strand, 39940157 - 39939985
Alignment:
| Q |
224 |
tgatcgatattcgccggagtgagtttgcgtgcggtgagttctcatgatctatcgatgatttgattctttctctgattcttctgcgccaccgcaaagttta |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39940157 |
tgatcgatattcgccggagtgagtttgcgtgcggtgagttctcatgatctatcgatgatttgattctttctctgattcttctgcgccaccgcaaaattta |
39940058 |
T |
 |
| Q |
324 |
cgctctagatcttgtactcacgtgctttacgtgtgatgatcgatattcttcgtcttgttatgcctcctttgct |
396 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39940057 |
cgctctagatcttgtactcacgtgctttgcgtgtgatgatcgatattcttcgtcttgttatgcctcgtttgct |
39939985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 39940370 - 39940219
Alignment:
| Q |
20 |
gcagtatctttctcctttatctacaaatcaaatgaaatgaaattaaga---------caagtaaataaaattatccttaaacataaaccctaaataacga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
39940370 |
gcagtatctttctcctttatctacaaatcaaatgaaatgaaattaagaagaattaaacaagtaaatacaattatccttaaacataaaccctaaataacaa |
39940271 |
T |
 |
| Q |
111 |
accttatcggagaaggtgtcggaagttaaagtgatgacttcggaattggtgg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39940270 |
accttatcggagaaggtgtcggaagttaaagtgatgacttcggaattggtgg |
39940219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University