View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5395_low_7 (Length: 240)
Name: NF5395_low_7
Description: NF5395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5395_low_7 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 3585552 - 3585455
Alignment:
| Q |
143 |
tagaaaaatgctttctcttttgacatgtggcgttaccaaaaattggataacactagaacacgtgtgttaatacttaccacaatcacttcctgcactgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3585552 |
tagaaaaatgctttctcttttgacatgtggcgttaccaaaaattggataacactagaacacgtgtgttaatacttaccacaatcactacctgcactgc |
3585455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 107
Target Start/End: Complemental strand, 3585673 - 3585560
Alignment:
| Q |
2 |
agagagaacaagtaaa-ggaagggttggtttttcttgagaacgattgaaa-------gggttttagggcgaaattgggaattaaatctcaacaaagggta |
93 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3585673 |
agagagaacaagtaaaaggaagggttggtttttcttgagaacgattgaaacttgaaagggttttagggcgaaattgtgaattaaatctcaacaaagggta |
3585574 |
T |
 |
| Q |
94 |
attttgtcatttag |
107 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3585573 |
attttgtcatttag |
3585560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University