View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5395_low_9 (Length: 230)
Name: NF5395_low_9
Description: NF5395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5395_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 8377896 - 8377698
Alignment:
| Q |
14 |
ttattcttagtaattaatttctttttcatatcaactatcttgctacacaaaatattagtgtacttacatgcttttaatgtannnnnnnnnngtaggtttt |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
8377896 |
ttatttttagtaattaatttctttttcatatcaactatcttgctacacaaaatattagtgtacttacatgcttttaacgt--tatttttttgtaggtttt |
8377799 |
T |
|
| Q |
114 |
ataattatggtattggaatacatttgattcagaatccggacattgatgaatttgatacttacatgaatgaatcaagacctattaatcccaaggataacca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8377798 |
ataattatggtattggaatacatttgattcagaatccggacattgatgaatttgatacttacatgaatgaatcaagacctattaatcccaaggataacca |
8377699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 214
Target Start/End: Complemental strand, 32249235 - 32249126
Alignment:
| Q |
105 |
gtaggttttataattatggtattggaatacatttgattcagaatccggacattgatgaatttgatacttacatgaatgaatcaagacctattaatcccaa |
204 |
Q |
| |
|
||||||| |||||||||||| |||||||||| || || ||||||| | ||||||||||||||| |||| ||||||| |||| ||||||||||| |
|
|
| T |
32249235 |
gtaggttgtataattatggttttggaatacacctgcttgagaatccaaattatgatgaatttgatacccctatgagtgaatcacgacccattaatcccaa |
32249136 |
T |
|
| Q |
205 |
ggataaccat |
214 |
Q |
| |
|
||| |||||| |
|
|
| T |
32249135 |
ggacaaccat |
32249126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University