View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5397-Insertion-6 (Length: 170)

Name: NF5397-Insertion-6
Description: NF5397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5397-Insertion-6
NF5397-Insertion-6
[»] chr2 (1 HSPs)
chr2 (9-159)||(3879609-3879759)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 3879759 - 3879609
Alignment:
9 aatcagctacggaataaaaatcttttcattaaaattgaatgtgaattttattatttatatcaaatggggaatatggagaataggttcaagacatacttgt 108  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3879759 aatcagctaaggaataaaaatcttttcattaaaattgaatgtgaattttattatttatatcaaatggggaatatggagaataggttcaagacatacttgt 3879660  T
109 tacatgcggtccatctaaaggcagcattgctttttgtcttgcatccagagg 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||    
3879659 tacatgcggtccatctaaaggcagcattgctttttgtcttgcatcgagagg 3879609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University