View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5397-Insertion-6 (Length: 170)
Name: NF5397-Insertion-6
Description: NF5397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5397-Insertion-6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 3879759 - 3879609
Alignment:
| Q |
9 |
aatcagctacggaataaaaatcttttcattaaaattgaatgtgaattttattatttatatcaaatggggaatatggagaataggttcaagacatacttgt |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879759 |
aatcagctaaggaataaaaatcttttcattaaaattgaatgtgaattttattatttatatcaaatggggaatatggagaataggttcaagacatacttgt |
3879660 |
T |
 |
| Q |
109 |
tacatgcggtccatctaaaggcagcattgctttttgtcttgcatccagagg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3879659 |
tacatgcggtccatctaaaggcagcattgctttttgtcttgcatcgagagg |
3879609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University