View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5397_low_15 (Length: 216)
Name: NF5397_low_15
Description: NF5397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5397_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 16753338 - 16753524
Alignment:
| Q |
15 |
caaagggtctttcttttcggtttatgagttgttcctt-gaggaagataggaggttgaaaattacaaaagag----------ttcccaaccatatgttaat |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
16753338 |
caaagggtctttcttttaggtttatgagttgttccttagaggaagataggaggttgaaaattacaagagaggaatcaaacgttcccaaccatatgttaat |
16753437 |
T |
 |
| Q |
104 |
gttttcatctcttaaccaaacaattgaacttgtagtcgctgtctttttgttctatcattccttctctacatgcagttttatttttaac |
191 |
Q |
| |
|
||||| || |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16753438 |
gttttaatttcttaaccaa-caattgaacttgtagtcgctgtctttctgttctatcattccttctctacatgcagttttatttttaac |
16753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University