View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5397_low_5 (Length: 382)
Name: NF5397_low_5
Description: NF5397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5397_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 3 - 370
Target Start/End: Original strand, 456558 - 456925
Alignment:
| Q |
3 |
gcaaacttcttcgactcagaactcccggaggcttctgttgccaaatcattcaacaacccatgcagagattggttgaaacgtcccaagtcaacgctagaga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456558 |
gcaaacttcttcgactcagaactcccggaggcttctgttgccaaatcattcaacaacccatgcagagattggttgaaacgtcccaagtcaacgctagaga |
456657 |
T |
 |
| Q |
103 |
caatatttccgtcgttaaggttgactctagggtcaatcttgtcgacggcaaagtacctatttgtgtaacgaacgaagcactcgtcgtaccagatgagtgc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
456658 |
caatatttccgtcgttaaggttgactctagggtcaatcttgtcgacggcaaagtacctatttgtgtaatgaaccaagcactcgtcgtaccagatgagtgc |
456757 |
T |
 |
| Q |
203 |
ttcggtttggtttggacaatgctgtcttatctctttgattgcagttgtgagacactggttacatacggtggtggcgacgtcgccacgacataggaagagt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456758 |
ttcggtttggtttggacaatgctgtcttatctctttgattgcagttgtgagacactggttacatacggtggtggcgacgtcgccacgacataggaagagt |
456857 |
T |
 |
| Q |
303 |
ccaccgacggcgttgacgctattgaaaccagtgatgctgagaaaataaccgttggattgagagatatt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
456858 |
ccaccgacggcgttgacgctattgaaaccagtgatgccgagaaaataaccgttggattgagagatatt |
456925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University