View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5399_low_1 (Length: 302)
Name: NF5399_low_1
Description: NF5399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5399_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 7906510 - 7906236
Alignment:
| Q |
16 |
aaaacttgttggtgaaattcaaactttgcaacaaaagtttgattctatgaatgaaaattggaagcagaaggaacttgttcaaagggctaatggaattttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906510 |
aaaacttgttggtgaaattcaaactttgcaacaaaactttgattctatgaatgaaaattggaagcagaaggaacttgttcaaagggctaatggaattttg |
7906411 |
T |
 |
| Q |
116 |
caagttgttatgtcaaggcttgaggatgagttggttcaaattcttgttaatcataagcaatattttgagcctgattacatgtctttcaattccaacagag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906410 |
caagttgttatgtcaaggcttgaggatgagttggttcaaattcttcttaatcatatgcaatattttgagcctgattacatgtctttcaattccaacagag |
7906311 |
T |
 |
| Q |
216 |
ttgatattgtgtatgatggatcatttggttcagttgaggatgaaaatatcaaccaggcgtcgcagagcagtgatg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7906310 |
ttgatattgtgtatgatggatcatttggttcagttgaggatgaaaatatcaacgaggcgtcgcagagcagtgatg |
7906236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University