View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_115 (Length: 218)
Name: NF5400_high_115
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_115 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 5 - 194
Target Start/End: Original strand, 36998066 - 36998251
Alignment:
| Q |
5 |
ataaggttgtaaaatctaacattaatatatggctgttttcaggtaaggctttgaaggacttaatgtgaaaagctgctaaggcaaacctcatcagttttga |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
36998066 |
ataaggttgtaaaatctaaca---atatatggctgttttcaggtaaggctttgaaggatttaatgtggaaagctgctaaggcaaacctcatcagttttta |
36998162 |
T |
 |
| Q |
105 |
atgtttctttggaagaaggctatgtcgaaaccattagttctatttaattccttnnnnnnnncattgttctatttaattaaaaatagaaaa |
194 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
36998163 |
acgtttctttggaagaaggctatgtcgaaaccattagttctatttaattcctt-aaaaaaacattgttctatttaattaaaaatacaaaa |
36998251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University