View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_118 (Length: 215)
Name: NF5400_high_118
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_118 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 43132572 - 43132385
Alignment:
| Q |
9 |
ggtagataatactaagttagtgggtacgttaatttctcaggatttgaacgctagactatattggacaagatgatttagaaccgagtacatattctccgtc |
108 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132572 |
ggtaaatattactaagttagtggatacgttaatttctcaggatttgaacgctagactatattggacaagatgatttagaaccgagtacatattctccgtc |
43132473 |
T |
|
| Q |
109 |
aagcataagcaaacacattcctaaaacagtataatatcgatgttactataaacgcgatagatactaacttgaattgatgatcatgtta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132472 |
aagcataagcaaacacattcctaaaacagtataatatggatgttactataaacgcgatagatactaacttgaattgatgatcatgtta |
43132385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University