View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_12 (Length: 566)
Name: NF5400_high_12
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 337; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 40174902 - 40174554
Alignment:
| Q |
1 |
tgctggtagaggtattcctccggcgccggttattcaagctcagcctggtcttgctggtcctgttcgtggtgttggtggacctgctcctggtatgatgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174902 |
tgctggtagaggtattcctccggcgccggttattcaagctcagcctggtcttgctggtcctgttcgtggtgttggtggacctgctcctggtatgatgcag |
40174803 |
T |
 |
| Q |
101 |
ccgcagatctcgcggccacctgtttcgtatcctggtggtccgcctgttatgcgtccgcctggtcaaatgccgtatcctggacatcctggacaaggtccac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174802 |
ccgcagatctcgcggccgcctgtttcgtatcctggtggtccgcctgttatgcgtccacctggtcaaatgccgtatcctggacatcctggacaaggtccac |
40174703 |
T |
 |
| Q |
201 |
cgcagatggtgaggggtccaccgcctcctatgccgccggggcaatttgggcagagaccaggtggtcctccaccacaatttggtatgccgcctcctcagta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40174702 |
cgcagatggtgaggggtccaccgcctcctatgccgccggggcaatttgggcagagaccaggtggtcctccaccacaatttggtatgccacctcctcagta |
40174603 |
T |
 |
| Q |
301 |
tgggcagagaccaatggggccacctcctcctggtcagatggtgagagga |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174602 |
tgggcagagaccaatggggccacctcctcctggtcagatggtgagagga |
40174554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 411 - 555
Target Start/End: Complemental strand, 40174489 - 40174345
Alignment:
| Q |
411 |
gaagtggtgttccggtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
510 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174489 |
gaagtggtgttcctgtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
40174390 |
T |
 |
| Q |
511 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
555 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174389 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
40174345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 111; Significance: 9e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 16 - 177
Target Start/End: Original strand, 34400736 - 34400900
Alignment:
| Q |
16 |
tcctccggcgccggttattcaagctcagcctggtcttgctggtcctgttcgtggtgttggtggacctgctcctggtatgatgcagccgcagatctcgcgg |
115 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34400736 |
tcctccggcgacagttattcaagctcagcctggtcttgctggtcctgttcgtggtgttggtggacctgctcctggtatgatgcagccgcaaatctcgcgt |
34400835 |
T |
 |
| Q |
116 |
ccacctgtttcgtatcctggtggtccgcctgttatgcgt---ccgcctggtcaaatgccgtatcc |
177 |
Q |
| |
|
|| || ||||||||||| ||||||||||| ||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
34400836 |
cctccggtttcgtatcccggtggtccgccggttatgcgtccaccgcctggtcagatgccatatcc |
34400900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 349
Target Start/End: Original strand, 34400973 - 34401057
Alignment:
| Q |
265 |
tcctccaccacaatttggtatgccgcctcctcagtatgggcagagaccaatggggccacctcctcctggtcagatggtgagagga |
349 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||| |||||||| ||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
34400973 |
tcctccgccacaattttccatgccgcctcctcagtttggacagagacctatgggcccacctcctcctggacagatgatgagagga |
34401057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University