View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_38 (Length: 390)
Name: NF5400_high_38
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 109 - 374
Target Start/End: Original strand, 8064316 - 8064581
Alignment:
| Q |
109 |
cattatgagtacgagtattacttgttgacaaacaaattttgtgaggttggattgtagtgtaaaattggtgaatcttggtcaacaaaatatttttgggaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8064316 |
cattatgagtacgagtattacttgttgacaaacaaattttgtgaggttggattgtagtgtaaaattggtgaatcttggtcaacaaaatatttttgggaaa |
8064415 |
T |
 |
| Q |
209 |
tggtgtaatctttttgtagtaatgttggagattctaagttatgtgagaactcgattttggtttggaagcaattgcgcataatgggaagaaaaagttactt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8064416 |
tggtgtaatctttttgtagtaatgttggagattctaagttatgtgagaactcgattttggtttggaagcaattgcgcataatgggaagaaaaagttactt |
8064515 |
T |
 |
| Q |
309 |
taagagaatctaaatagtacaaatattctgtcaaaaaatcactaaaatattttcgtaacaatttat |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8064516 |
taagagaatctaaatagtacaaatattctgtcaaaaaatcactaaaatattttcgtaacaatttat |
8064581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University