View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_48 (Length: 337)
Name: NF5400_high_48
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 43953551 - 43953277
Alignment:
| Q |
1 |
attcatgttaactca--atatttttgaatgaattattacactagctagcctctcctcttatttatgatactcatacgaacaccctttcaagtttcgtcca |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953551 |
attcatgttaactcacaatatttttgaatgaatta---cactagctagcctctcctctgatttatgatactcatacgaacaccctttcaagtttcgtcca |
43953455 |
T |
 |
| Q |
99 |
tctaacgatttattcccttggaaccttgaaaagttcgcttcttccagctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953454 |
tctaacgatttattcccttggaaccttgaaaagttcgcttcttccagctattatgattttgtagacaatgaactcaccaatgcttaacttaatcaaggtt |
43953355 |
T |
 |
| Q |
199 |
tcaacatgtgcaagagtaaccatgaatgtcctccattattatgctgctcctcggagaaattttgttgtcttatttgac |
276 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953354 |
tcaacatgtgcatgagtaaccatgagtgtcctccattattatgctgctcctcggagaaattttgttgtcttatttgac |
43953277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 276 - 337
Target Start/End: Complemental strand, 43953234 - 43953173
Alignment:
| Q |
276 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacaccgccaaataaacatt |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953234 |
ctaatttatttctatgccatgggatgcaacatcaatgattgtgacaccgccaaataaacatt |
43953173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University