View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_56 (Length: 295)
Name: NF5400_high_56
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 5042200 - 5041930
Alignment:
| Q |
18 |
ttggattggtgctctagttcttgcagctattcagctgcatctagtagtagaattctggtaagatatttagttcaaaacttacttttctacttcatatagt |
117 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042200 |
ttggatttgtgttctagttcttgcagctattcagctgcatctagtagttgaattctggtaagatatttagttcaaaacttacttttctacttcatatagt |
5042101 |
T |
|
| Q |
118 |
agtttagataaactatgaatcactggtctggacacaaacaccagac---acgttactgacactcacatgttgacacttgt-nnnnnnnggtgtttaattg |
213 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
5042100 |
tgt---gataaactatgaatcactggtctggacacaaacaccagacacgacgttactgacactcatatgttgacacttgtaaaaaaaaggtgtttaattg |
5042004 |
T |
|
| Q |
214 |
attcatgtgtgctagtatggtgttagtgttcgtgtcaaacactaaacacatctacgatctgaaatatctgtgct |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5042003 |
attcatgtgtgctagtatcgtgttagtgttagtgtcagacactaaacacatctacgatctgaaatatctatgct |
5041930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University