View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_78 (Length: 251)
Name: NF5400_high_78
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_78 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 882493 - 882249
Alignment:
| Q |
4 |
aggccaaaacatgattcttttgttgttaaataacaggatgcttctggattaactcaattaagttcgacagtggaggatgtatttgccactggtgatctcc |
103 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| |||| |||||||||||||||||||| || ||||||||||| | || ||||||||||| |
|
|
| T |
882493 |
aggccaaaacttgattcttttgtggttaaataacaggatgctgctgggttaactcaattaagttcgaccgtagaggatgtattcgacagtggtgatctcc |
882394 |
T |
|
| Q |
104 |
ctcgtgctgccgaaacactggctaatatgaggcactgcttgtctgctgtcggggaggtactaa-----nnnnnnnnggttatctatgaagtacacgaggt |
198 |
Q |
| |
|
|| ||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
882393 |
cttgtgctgctgaaactctggctaatatgaggcattgcttgtctgctgtcggggaggtactaatttttcccattttgtttatctatgaagtacacgaggt |
882294 |
T |
|
| Q |
199 |
ttggtacatttactttttgtatttacaattgttttcgcctttgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
882293 |
ttggtacatttactttttgtatttacaattgctctcgcctttgct |
882249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 852145 - 851915
Alignment:
| Q |
19 |
tcttttgttgttaaataacaggatgcttctggattaactcaattaagttcgacagtggaggatgtatttgccactggtgatctccctcgtgctgccgaaa |
118 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
852145 |
tcttttgtggttaaataacaggatgctgctggattaactcaattaagttcgactgtggaggatgtatttaccagtggtgatctcccccgtgctgccgaaa |
852046 |
T |
|
| Q |
119 |
cactggctaatatgaggcactgcttgtctgctgtcggggaggtactaa------nnnnnnnnggttatctatgaagtacacgaggtttggtacatttact |
212 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||| |||||||| | ||||||| |||||| ||| || |||||||||||||||| |
|
|
| T |
852045 |
ctctggctaatatgaggcattgcttgtctgctgtcggagaggtactgatttgttcccattttggttatcgatgaagcacatgaagtttggtacatttact |
851946 |
T |
|
| Q |
213 |
ttttgtatttacaattgttttcgcctttgct |
243 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |
|
|
| T |
851945 |
ttttgtatttacaattgttcttgcctttgct |
851915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 36 - 166
Target Start/End: Complemental strand, 239454 - 239324
Alignment:
| Q |
36 |
acaggatgcttctggattaactcaattaagttcgacagtggaggatgtatttgccactggtgatctccctcgtgctgccgaaacactggctaatatgagg |
135 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| ||||| ||||||||||||| |||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
239454 |
acaggatgctgctggattaactcaattgagttcgacggtggaagatgtatttgccagtggtgatctccctcgtgccgctgaaactttggctaatatgagg |
239355 |
T |
|
| Q |
136 |
cactgcttgtctgctgtcggggaggtactaa |
166 |
Q |
| |
|
|| |||||||||||||| ||||||||||||| |
|
|
| T |
239354 |
cattgcttgtctgctgttggggaggtactaa |
239324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University