View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_82 (Length: 250)
Name: NF5400_high_82
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 31 - 216
Target Start/End: Complemental strand, 10268523 - 10268338
Alignment:
| Q |
31 |
gagtgactaaaaattcatctttaaaatgaataaattgagtgtcaggagttcaaacaccgacctccacagatattatgcaatgtctctcttgatctggtgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
10268523 |
gagtgactaaaaattcatctttaaaatgaataaattgagtgtcaggagttcaaacaccgacctccacaaatattatgcaatgtctctcttggtctagtgg |
10268424 |
T |
 |
| Q |
131 |
tattaactcgagatctgtaaacgtgctcattcccgagatctcaagttcgattcagattcaagttggatgaggtcctttagtttctt |
216 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||| |||||||||| ||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
10268423 |
tattaacttgagatctgtgcacgtgctccttctcgagatctcaggttcgattcagattcaagttggatgaggtaatttaatttctt |
10268338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University