View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_92 (Length: 242)
Name: NF5400_high_92
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_92 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 102)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 9951344 - 9951544
Alignment:
| Q |
1 |
attatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacatgaatgaagtgatcttctaaattttaacagcttaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9951344 |
attatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacaagaatgaagtgatcttcaaaattttaacagcttaatt |
9951443 |
T |
 |
| Q |
101 |
ttataaatataacattttagaaaattaatatgattgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaa |
200 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||||| ||| ||||||| ||||| | ||||| | |||||| ||||||||||| |
|
|
| T |
9951444 |
ttataaatataacttattagaaaattaatatgattgtcttcatgagcatagctcgattggcagaaacatgtattattatatacaggggtcggggttcgaa |
9951543 |
T |
 |
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
9951544 |
c |
9951544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 146 - 229
Target Start/End: Complemental strand, 3341827 - 3341744
Alignment:
| Q |
146 |
gcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| || |||||||||||||||| | ||||| |||||||||||||| |||||| ||||||||||||||||||| ||||||| |
|
|
| T |
3341827 |
gcatagctcagttggcagggacatgcattattatatgcaggggccggggatcgaaccccggacaccccacttattcaccttgaa |
3341744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 9768903 - 9768817
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| |||||||| |||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
9768903 |
tgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttgaa |
9768817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 229
Target Start/End: Original strand, 43020603 - 43020698
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| | ||||| |||||||| ||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
43020603 |
ttgtctcggtgagcatagctcggttggcagggacatgcattattatatgcaggggttggggttcgaacctcggacaccccactcattcaccttgaa |
43020698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 50199557 - 50199484
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| |||||||||| | |||| ||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
50199557 |
gttggtagggacatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgaa |
50199484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 39238707 - 39238795
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | ||||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
39238707 |
ttgtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattc |
39238795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 40678814 - 40678902
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
40678814 |
ttgtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattc |
40678902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 142 - 229
Target Start/End: Complemental strand, 9769675 - 9769588
Alignment:
| Q |
142 |
atgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||| || |||||||||||||||| | ||||| || |||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
9769675 |
atgagcatagctcagttggcagggacatgcattattatatgtagggattggggttcgaaccccggacaccccacttattcaccttgaa |
9769588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 17350061 - 17350140
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17350061 |
tgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
17350140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 29491470 - 29491549
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
29491470 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
29491549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 195045 - 195131
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| ||| || |||||||||||||||| ||||||| ||||||||| | |||||| || || |||||||||||||||| ||||||| |
|
|
| T |
195045 |
tgagcgtagctcagttggcagggacatgcataattatatgcaggggctgaggttcgtaccccagacaccccacttattcaccttgaa |
195131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 18003817 - 18003895
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| ||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
18003817 |
tgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattc |
18003895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 41677061 - 41677147
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| ||| || |||||||| ||||| | | ||||| ||| |||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41677061 |
tgagcgtagctcagttggcagagacattcattattatatgcgggggtcggggttcgaactccggacaccccacttattcaccttgaa |
41677147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 42908772 - 42908850
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||| || |||||||||||||||| | |||| |||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
42908772 |
tgagcttagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaactccggataccccacttattc |
42908850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 52961176 - 52961098
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||| |||||||| | |||| ||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
52961176 |
tgagcatagctcagttggcaaggacatgcattgttatatgcaggggccggggttcgaaccccggacgccccacttattc |
52961098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 2052777 - 2052700
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | || || ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2052777 |
tgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 38021242 - 38021331
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| || ||||||||| || ||||||| ||||| ||| | ||||| |||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
38021242 |
attgtccccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattc |
38021331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 4354167 - 4354116
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4354167 |
attatatgcaggggccggggttcgaacttcggacaccccacttattcacctt |
4354116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 13870176 - 13870097
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
13870176 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttattc |
13870097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 11238122 - 11238044
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || | ||||| |||||||| | ||||| |||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
11238122 |
tgagcatagctcagatggcatggacatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattc |
11238044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 15368838 - 15368884
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15368838 |
attatatgcaggggccggggttcgaaccccggacaccccacttattc |
15368884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 131 - 217
Target Start/End: Complemental strand, 23464091 - 23464006
Alignment:
| Q |
131 |
tgattgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| || ||||| ||| |||| | ||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23464091 |
tgattgtc-ccatgagcatagttcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
23464006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 136 - 226
Target Start/End: Original strand, 40679785 - 40679869
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| ||| || ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
40679785 |
gtctccatgagcatagttcagttagcagggacatgc---attgtt---aggggccggggttcgaacttcggacaccccacttattctcctt |
40679869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 1576202 - 1576129
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||||| |||| | ||||| ||||||||||||| ||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
1576202 |
gttggcagggatatgctttattatatgcaggggccgggattcaaaccccggacaccccacttatttaccttgaa |
1576129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 221
Target Start/End: Original strand, 16182812 - 16182888
Alignment:
| Q |
145 |
agcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| || |||||||| ||||||| | ||||| || |||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
16182812 |
agcatagctcagttggcagagacatgcattattatatgtaggggctggggttcaaaccccggacaccccacttattc |
16182888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 19976656 - 19976568
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| || | |||| ||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19976656 |
ttgtccccgtgagcatagctcagttggcagggacaatgtatggttatatgcaggggccggggttcgaaccccggacaccccacatattc |
19976568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 24134680 - 24134640
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24134680 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
24134640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 25031553 - 25031513
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25031553 |
tgcaggggccggggttcgaattccggacaccccacttattc |
25031513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 1721141 - 1721224
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| ||| |||||| | |||| ||||||||||||| ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
1721141 |
tgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcacctt |
1721224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 4611274 - 4611227
Alignment:
| Q |
194 |
gttcgaactccggacaccccacttattcgccttgaatagaggtgaatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4611274 |
gttcgaactccggacaccccacttatttaccttgaataaaggtgaatt |
4611227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 190 - 229
Target Start/End: Complemental strand, 9976431 - 9976392
Alignment:
| Q |
190 |
cggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9976431 |
cggggttcgaactccggacaccccacttattcaccttgaa |
9976392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19424079 - 19424130
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19424079 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
19424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 25819185 - 25819264
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| || ||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
25819185 |
tgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttattc |
25819264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 221
Target Start/End: Complemental strand, 40454242 - 40454187
Alignment:
| Q |
166 |
acatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| | ||||| |||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40454242 |
acatgcattattatatgcaagggccggggttcgaactccggacacccaacttattc |
40454187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 47763480 - 47763401
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| |||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
47763480 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttattc |
47763401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 11405490 - 11405540
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11405490 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11405540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 221
Target Start/End: Original strand, 12553187 - 12553273
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccgggg-ttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| |||||| || || ||||| ||| |||||| | |||| |||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
12553187 |
gtctccgtgagcacagctcagttggtaggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttattc |
12553273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 21265692 - 21265734
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21265692 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
21265734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 226
Target Start/End: Complemental strand, 24168680 - 24168590
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| ||||||||| || ||| | ||| |||||| | ||||| || |||| ||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
24168680 |
gtctccgtgagcatagctcagtttgtaggaacatgcattattatatgtagggaccggggttcgaaccccagacaccccacttattcacctt |
24168590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 217
Target Start/End: Complemental strand, 31124707 - 31124630
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| ||| || ||||||| |||||| || ||||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31124707 |
ccatgagcttagctcagttggcaaggacattgcataatt-tatgcaggggccggggttcgaactccggataccccactt |
31124630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 33207241 - 33207283
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33207241 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
33207283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 48260283 - 48260197
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||||||||| ||| | ||||| || |||| ||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
48260283 |
tgagcatagctcagttggcagggatgtgcattattatatgtcggggtcggagttcgaaccccggacaccccacttattcaccttgaa |
48260197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 52833188 - 52833122
Alignment:
| Q |
156 |
gttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
52833188 |
gttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattc |
52833122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 2903108 - 2903035
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| ||||||||||| | |||| ||||| || |||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
2903108 |
gttgccagggacatgcattgttatatgcagaggtcggggttcgaaccccgaacaccccacttattcaccttgaa |
2903035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 7438663 - 7438700
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7438663 |
aggggtcggggttcgaactccggacaccccacttattc |
7438700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 7906420 - 7906343
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||| || ||||| |||||||||| | |||| ||||||||| ||||||||||| | ||||||||| |||||| |
|
|
| T |
7906420 |
tgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaacccgggacaccccgcttatt |
7906343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 18512608 - 18512567
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18512608 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
18512567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 40061485 - 40061522
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40061485 |
aggggctggggttcgaactccggacaccccacttattc |
40061522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 1660966 - 1661030
Alignment:
| Q |
165 |
gacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||||||| ||| |||| ||||| |||| ||||||| |
|
|
| T |
1660966 |
gacatgcattattatatgcaggggccggggttcgaaccccgaacactccactcattctccttgaa |
1661030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 229
Target Start/End: Original strand, 18179319 - 18179415
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| || |||||||| || |||||||||||||||| | |||| ||||||| |||| |||||||| || ||||||| ||||||| ||||||| |
|
|
| T |
18179319 |
attgtccccgtgagcataactcagttggcagggacatgcattgttatatgcagggaccggagttcgaaccccagacaccctgcttattctccttgaa |
18179415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 29936737 - 29936697
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
29936737 |
tgcaggggtcggagttcgaactccggacaccccacttattc |
29936697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 34702369 - 34702329
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34702369 |
tgcaggggccggggttcgaaccccggacacctcacttattc |
34702329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 36666604 - 36666568
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36666604 |
tgcaggggccggggttcgaaccccggacaccccactt |
36666568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 538391 - 538340
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| ||| ||||||||||||||| |||| |
|
|
| T |
538391 |
attatatgcaggggccggagttcgaaccccgaacaccccacttattcacctt |
538340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 2643909 - 2643826
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| | |||||||| ||||||| | ||||| |||| ||| ||||||| |||| || |||||||||||||||| |||| |
|
|
| T |
2643909 |
tgagcatagcttagttggcagagacatgcattattatatgcatgggtcggggtttgaaccccagacaccccacttattcacctt |
2643826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 218
Target Start/End: Complemental strand, 7015781 - 7015706
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccactta |
218 |
Q |
| |
|
||||||||| || |||||| ||||||||| | |||| || |||||| | ||||||||||||| |||||||||||| |
|
|
| T |
7015781 |
tgagcatagctcagttggctgggacatgcattgttatatgtaggggctgaggttcgaactccgaacaccccactta |
7015706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 9527426 - 9527505
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | |||| |||||||| ||||||| |||| | ||||||||||||||||| |
|
|
| T |
9527426 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattc |
9527505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 15774374 - 15774323
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || ||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
15774374 |
attatatgtaggggtcggggttcgaaccccggacaccccacttattcacctt |
15774323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 17056942 - 17056891
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||| |||||||||||| |||| |
|
|
| T |
17056942 |
attatatgcaggggccggggttcgaaccccagacgccccacttattcacctt |
17056891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19793559 - 19793610
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
19793559 |
attatatgcaggggccggaattcgaaccccggacaccccacttattcacctt |
19793610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 21884608 - 21884659
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||| || |||||||||||||||| |||| |
|
|
| T |
21884608 |
attatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
21884659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 37733788 - 37733839
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||| || |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37733788 |
attatatgcagtggacggggttcgaaccccggacaccccacttattcacctt |
37733839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 42831980 - 42832031
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| ||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
42831980 |
attatatgcaggggctggggttcaaaccccggacaccccacttattcacctt |
42832031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 42946529 - 42946478
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| |||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
42946529 |
attatatgcaggggctggggtttgaaccccggacaccccacttattcacctt |
42946478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 226
Target Start/End: Complemental strand, 47939245 - 47939210
Alignment:
| Q |
191 |
ggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47939245 |
ggggttcgaactccggacaccccacttattcacctt |
47939210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 49251457 - 49251406
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| || |||||||||||||||| |||| |
|
|
| T |
49251457 |
attatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
49251406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 217
Target Start/End: Complemental strand, 7000984 - 7000954
Alignment:
| Q |
187 |
ggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7000984 |
ggccggggttcgaactccggacaccccactt |
7000954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 7180648 - 7180606
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7180648 |
attatatgcaggggccggagttcgaaccccggacaccccactt |
7180606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 7550046 - 7550088
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
7550046 |
attatttgcaggggccggggttcgaaccccggattccccactt |
7550088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 13538480 - 13538438
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13538480 |
attatatgcaggggccggggttcgaaccccggacactccactt |
13538438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 13941320 - 13941398
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||| || ||||||| |||||||| | |||| ||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
13941320 |
tgagtatagttcagttggcaaggacatgcattgttatatgcagggttcgaggttcgaacttcggacaccccacttattc |
13941398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 19063367 - 19063325
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
19063367 |
attatatgcaggggccggggttcgtaccccggacaccccactt |
19063325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 22563422 - 22563464
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22563422 |
attatatgcaggggccggggttcgaaccccggacactccactt |
22563464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 23991317 - 23991256
Alignment:
| Q |
156 |
gttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||| || ||||| | ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
23991317 |
gttggcagggacattgcataatt-tatgcaggggccggggttcgaaccctggacaccccactt |
23991256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 24014670 - 24014624
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
24014670 |
attatatgcaggggccggagttcgaactctggacaccccaattattc |
24014624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 35068723 - 35068765
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
35068723 |
attatatggaggggccggggttcgaaccccggacaccccactt |
35068765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 36314013 - 36313971
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
36314013 |
attatttgcaggggccggagttcgaaccccgaacaccccactt |
36313971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 226
Target Start/End: Original strand, 39433356 - 39433442
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||| || ||||| | | | |||| | ||||| ||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
39433356 |
ccatgagcatagttcagttggtatgaaaatgcattattatatgcaggggccgatgttcgaacctcggacaccccacttattcacctt |
39433442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 42367748 - 42367794
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
42367748 |
attatatgcaggggccggggttcgaatcccggacaacccacttattc |
42367794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 42490444 - 42490402
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42490444 |
attatatgcaggggtcggggttcgaaccccggacaccccactt |
42490402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 44732669 - 44732711
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
44732669 |
attatatgcaagggccggggttcgaaccccggacaccccactt |
44732711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 49606760 - 49606714
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
49606760 |
attatatgtaggggccggagttcgaacttcggacaccccacttattc |
49606714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 6463069 - 6463028
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6463069 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
6463028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 19866490 - 19866559
Alignment:
| Q |
157 |
ttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||| | | ||| || |||||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
19866490 |
ttggcagggacatgcattagtatatgtaggggccgaagtttaaactccggacaccccacttattcacctt |
19866559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 29332323 - 29332368
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
29332323 |
tgcatgggccggggtttgaaccccggacaccccacttattcacctt |
29332368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 32635179 - 32635224
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
32635179 |
tgcaggggttggggttcgaaccccggacaccccacttattcacctt |
32635224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 41182808 - 41182853
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
41182808 |
ttatatgcaggggtcggggtttgaaccccggacaccccacttattc |
41182853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 44440613 - 44440654
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
44440613 |
ttatatgcaagggcaggggttcgaactccggacaccccactt |
44440654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 46116230 - 46116185
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
46116230 |
tgcaggggctggggttcgaaccccggacaccccaattattcacctt |
46116185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 50859423 - 50859378
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| ||||| |||| |
|
|
| T |
50859423 |
tgcaggggccggggttcaaaccccggacaccccacatattcacctt |
50859378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 10052499 - 10052463
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
10052499 |
tgcaggggccgaggttcgaaccccggacaccccactt |
10052463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 11333706 - 11333742
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11333706 |
tgcaggggccggagttcgaaccccggacaccccactt |
11333742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 11491727 - 11491763
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11491727 |
tgcaggggccggagttcgaaccccggacaccccactt |
11491763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 14262777 - 14262737
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
14262777 |
tgcaggggtcggggttcgaaccccggacaccctacttattc |
14262737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 17889109 - 17889145
Alignment:
| Q |
190 |
cggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
17889109 |
cggggttcgaactccggacatcccacttattcacctt |
17889145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 242
Target Start/End: Original strand, 24889184 - 24889239
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaattt |
242 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| | ||||| | |||||||||| |
|
|
| T |
24889184 |
gggccgaggttcgaactccgaacaccccacttattcactttgaa-aaaggtgaattt |
24889239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 30519422 - 30519462
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30519422 |
tgcaggggccgatgttcaaactccggacaccccacttattc |
30519462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 32585387 - 32585423
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32585387 |
tgcaggggcaggggttcgaaccccggacaccccactt |
32585423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 32711195 - 32711155
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
32711195 |
gggccggggttcgaaccccagacaccccacttattcacctt |
32711155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 37262199 - 37262118
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||| ||||||| | ||||| ||| ||||| ||||||||||||| |||| |
|
|
| T |
37262199 |
tgagcatagttcagttggcagggacatgcgttgttatatgcagggtc--aggttcaaaccccggataccccacttattcacctt |
37262118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 43109294 - 43109254
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
43109294 |
tgcaggggccggggttcgaaccccggacacctcatttattc |
43109254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 45416206 - 45416170
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45416206 |
tgcaggggccggggttcgaatcccggacaccccactt |
45416170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 68)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 140 - 229
Target Start/End: Original strand, 30833015 - 30833104
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||| || |||||||||||||||| | |||| |||||||| |||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
30833015 |
ccatgagcatagttcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattctccttgaa |
30833104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 26669753 - 26669667
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||| |||||||||| ||||||| || |||||| ||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
26669753 |
tgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcaccttgaa |
26669667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 10455743 - 10455830
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggaca-ccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||||||| |||||| | |||| ||||||||||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
10455743 |
tgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaaccccggacacccccacttattctccttgaa |
10455830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 14981797 - 14981718
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14981797 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattc |
14981718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 9064866 - 9064944
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
9064866 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
9064944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 34524876 - 34524954
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| ||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
34524876 |
tgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattc |
34524954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 241
Target Start/End: Original strand, 8309162 - 8309263
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaa |
239 |
Q |
| |
|
|||||||||||| || |||||||||||||||| | |||| |||| ||||| | ||||||| ||||||||||||| ||||| ||||||| | ||||||| |
|
|
| T |
8309162 |
ccatgagcatagctcagttggcagggacatgcattgttatatgcatgggccaagtttcgaaccccggacaccccacctattcaccttgaaaaaaggtgaa |
8309261 |
T |
 |
| Q |
240 |
tt |
241 |
Q |
| |
|
|| |
|
|
| T |
8309262 |
tt |
8309263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 19680329 - 19680256
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| |||||||| | |||| |||||| |||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19680329 |
gttggcatggacatgcattgttatatgcaggagccggggttcgaaccccggacaccccacttattctccttgaa |
19680256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 22983613 - 22983659
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22983613 |
attatatgcaggggccggggttcgaaccccggacaccccacttattc |
22983659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 23804795 - 23804749
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23804795 |
attatatgcaggggccggggttcgaaccccggacaccccacttattc |
23804749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 24256917 - 24257003
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| || ||||| || ||||||| | ||||| ||||||||||| ||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
24256917 |
tgagcataagtcagttggtagagacatgcattattatatgcaggggccgaggttcgaaccccggataccccacttattcaccttgaa |
24257003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 6658599 - 6658554
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6658599 |
tgcaggggccggggttcgaaccccggacaccccacttattctcctt |
6658554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 3448343 - 3448431
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || |||||||||||| ||| | |||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3448343 |
ttgtccccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattc |
3448431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 4854362 - 4854322
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4854362 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
4854322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 6228316 - 6228276
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6228316 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
6228276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 18903423 - 18903383
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18903423 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
18903383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 9491797 - 9491746
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
9491797 |
attatatgtaggggccggggttcgaaccccggacaccccacttattcacctt |
9491746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 12089130 - 12089181
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
12089130 |
attatatgcaggggccggagttcgaaccccggacaccccacttattcacctt |
12089181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 25020590 - 25020539
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25020590 |
attatatgcaggggcctgggttcgaaccccggacaccccacttattcacctt |
25020539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 229
Target Start/End: Original strand, 6455458 - 6455540
Alignment:
| Q |
147 |
catagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| || ||||| |||||||| | | ||||| || | |||| |||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
6455458 |
catagttcagttggtagggacatacattattatatgtatgggctggggttcgaactccggacaccctacttattcaccttgaa |
6455540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 241
Target Start/End: Original strand, 8175997 - 8176095
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaatt |
241 |
Q |
| |
|
||||||||| || |||| ||| ||||||| | |||| ||||||| | || |||||||||||| ||||||||||||||| |||| || | ||||||||| |
|
|
| T |
8175997 |
tgagcatagctcagttgacagagacatgcattgttatatgcagggactggtgttcgaactccgaacaccccacttattcaccttaaaaaaaggtgaatt |
8176095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 241
Target Start/End: Original strand, 9422834 - 9422932
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaatt |
241 |
Q |
| |
|
|||||||| || |||||||||||||||| | |||| | || | || ||||||||||| ||||||||||||||||||| |||||| | ||||||||| |
|
|
| T |
9422834 |
tgagcataactcagttggcagggacatgcattgttatatacaagagctggggttcgaacaccggacaccccacttattcaccttgataaaaggtgaatt |
9422932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 226
Target Start/End: Complemental strand, 5641738 - 5641701
Alignment:
| Q |
189 |
ccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5641738 |
ccggggttcgaactccggacaccccacttattcacctt |
5641701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 8253671 - 8253599
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| |||||||| | |||| ||||||||| ||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
8253671 |
gttggcatggacatgcattgttatatgcaggggctggggttcgaac-ccagacaccccacttattcaccttgaa |
8253599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 8297664 - 8297705
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8297664 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
8297705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 27667197 - 27667238
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27667197 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
27667238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 32344678 - 32344723
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32344678 |
tgcaggggttggggttcgaactccggacaccccacttattcacctt |
32344723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 2251880 - 2251916
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2251880 |
tgcaggggccggggttcgaaccccggacaccccactt |
2251916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 16251586 - 16251534
Alignment:
| Q |
174 |
aattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
16251586 |
aattatatgcaggggtcgttgttcgaactccggacaccccacttattcacctt |
16251534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 18904734 - 18904694
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18904734 |
gggccggggttcgaactctggacaccccacttattcacctt |
18904694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 20415618 - 20415578
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20415618 |
tgcaggggccagggttcgaaccccggacaccccacttattc |
20415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 220
Target Start/End: Complemental strand, 20858464 - 20858400
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
20858464 |
gttggcagggacatgcattgttatatgcaggggttggggttcgaattccggacaccccatttatt |
20858400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 2945587 - 2945674
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | |||| |||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
2945587 |
ttgtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 6143965 - 6144043
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| || ||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
6143965 |
tgagcatagctcagttggcagggacaatgcattattatatgtaggggtcggg-ttcgaaccccggacaccccacttattc |
6144043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 6530266 - 6530215
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
6530266 |
attatatgcaggggccggggttcaaacctcggacaccccacttattcacctt |
6530215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 12101919 - 12101970
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||| |||||||| |||| |
|
|
| T |
12101919 |
attatatgcaggggccggcgttcgaaccccggacaccctacttattcacctt |
12101970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 19279482 - 19279533
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
19279482 |
attatatgcaggggccggagttcgaacctcggacaccccacttattcacctt |
19279533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 34396116 - 34396167
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| | |||||| |||| |
|
|
| T |
34396116 |
attatatgcaggggccggagttcgaactccggacaccctatttattcacctt |
34396167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 492938 - 492980
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
492938 |
attatatgcaggggccggggttcgaaccctggacaccccactt |
492980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 978168 - 978126
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
978168 |
attatatgcaggggtcggggttcgaacaccggacaccccactt |
978126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 1969032 - 1969070
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacacccc |
213 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
1969032 |
attatatgcaggggccggggttcgaaccccggacacccc |
1969070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 3294800 - 3294842
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3294800 |
attatatgcaggggtcggggttcgaaccccggacaccccactt |
3294842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 10377186 - 10377140
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
10377186 |
attatatgcagaggccggggttcgaaccccgaacaccccacttattc |
10377140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 231
Target Start/End: Original strand, 11520732 - 11520806
Alignment:
| Q |
157 |
ttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaata |
231 |
Q |
| |
|
|||||||||| |||| | |||| ||||| ||||||||||||||||||| |||| || |||||| ||||||||| |
|
|
| T |
11520732 |
ttggcagggatatgcattcttatatgcagtggccggggttcgaactccgaacacatcatttattcaccttgaata |
11520806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 14709054 - 14709012
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14709054 |
attatatgtaggggccggggttcgaactccggacactccactt |
14709012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 15091484 - 15091526
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15091484 |
attatatgcaggggccggggttcgaatcccggacaccccactt |
15091526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 15289017 - 15288971
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
15289017 |
attatatgtaggggctggggttcgaactccagacaccccacttattc |
15288971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 17305530 - 17305604
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggcc-ggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| |||||||||| | ||||| |||||||| | |||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
17305530 |
gttggtagggacatgcattattatatgcagggggcaggggttcgaatcctggacaccccacttattcaccttgaa |
17305604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 211
Target Start/End: Original strand, 17534889 - 17534919
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacacc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17534889 |
tgcaggggccggggttcgaactccggacacc |
17534919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 242
Target Start/End: Complemental strand, 20568313 - 20568254
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaattt |
242 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
20568313 |
tgcaggggtcggggttcgaaccccgaacaccccacttattcacctt--ataaaggtgaattt |
20568254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 21507263 - 21507217
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
21507263 |
attatatgcaggggtcggagtttgaactccggacaccccacttattc |
21507217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 23771066 - 23771112
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23771066 |
attatatgcaggggaaggggttcgaactccggacaccccatttattc |
23771112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 25064763 - 25064689
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||| || ||||| | |||||||| | ||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
25064763 |
tgagcatagttcagttggtatggacatgcattattatatgcaggggttggggttcgaaccccagacaccccactt |
25064689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 7233999 - 7234052
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| ||||||||| |||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
7233999 |
ttatatgcaggggctggggtttgaacctcggacaccccacttattcaccttgaa |
7234052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 7374130 - 7374061
Alignment:
| Q |
157 |
ttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||| | |||| || | ||| ||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
7374130 |
ttggcagggacatgcattgttatatgtatgggtcggagttcgaactccgaacaccccacttattcacctt |
7374061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 17217000 - 17217037
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
17217000 |
aggggtcggagttcgaactccggacaccccacttattc |
17217037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 17751418 - 17751353
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| |||||||| | |||| |||||| || | ||||||||| ||||||||||||||||||| |
|
|
| T |
17751418 |
gttggcatggacatgcattgttatatgcaggagcagaggttcgaaccccggacaccccacttattc |
17751353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 18904302 - 18904343
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
18904302 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
18904343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Original strand, 30705005 - 30705038
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
30705005 |
aggggccggggttcgaaccccggacaccccactt |
30705038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 35038730 - 35038697
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacacccca |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
35038730 |
tgcaggggccggggttcgaaccccggacacccca |
35038697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 3974480 - 3974520
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
3974480 |
tgcaggggtcggggttcgaacttcggactccccacttattc |
3974520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 7897146 - 7897110
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7897146 |
tgcaggggtcggggttcgaaccccggacaccccactt |
7897110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 11552910 - 11552950
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
11552910 |
tgcaggggccggggttcgaaccccaggcaccccacttattc |
11552950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 16801822 - 16801874
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| |||||| | ||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
16801822 |
attatatgcaggagtcggggttcgaattccggacacaccacttattcaccttg |
16801874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 24319055 - 24319091
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24319055 |
tgcaggggccggggttcgaaccccggacactccactt |
24319091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 30938430 - 30938478
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| ||||||||||||| || ||||||| |||||||| ||||||| |
|
|
| T |
30938430 |
tgcagggaccggggttcgaaccccagacaccctacttattctccttgaa |
30938478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 32541046 - 32540962
Alignment:
| Q |
142 |
atgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||| || |||||||| ||||||| | ||||| | || || ||| ||||||||||| || ||||||||||||| |||| |
|
|
| T |
32541046 |
atgagcatagttcagttggcagagacatgcattattatatatagaggtcggagttcgaactccagataccccacttattcacctt |
32540962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 32788882 - 32788846
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32788882 |
tgcaggggttggggttcgaactccggacaccccactt |
32788846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 99)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 226
Target Start/End: Original strand, 20610731 - 20610823
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||| | |||| ||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
20610731 |
ttgtctctgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaactccggacatcccacttattcacctt |
20610823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 143 - 241
Target Start/End: Original strand, 49319394 - 49319492
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaatt |
241 |
Q |
| |
|
||||||||| || ||||||| |||||||| | ||||| |||||||| |||||||| ||| ||||||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
49319394 |
tgagcatagctcagttggcatggacatgcattattatatgcaggggtcggggttccaaccccggacaccccacttattcaccttgaaaaaaggtgaatt |
49319492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 54854273 - 54854187
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||| | ||||||||| ||||||| |
|
|
| T |
54854273 |
tgagcatagctcagttggcagggacatgcataattatatgcaggggctggggttcgaaccccggacatcacacttattcaccttgaa |
54854187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 28520826 - 28520747
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28520826 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
28520747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 48968305 - 48968226
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48968305 |
tgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
48968226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 41492592 - 41492507
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| | ||||| ||||||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
41492592 |
tgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaac-ctggacaccccacttatttaccttgaa |
41492507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 42411549 - 42411471
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||| || ||||||||||||| ||| ||||||| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
42411549 |
tgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 49039539 - 49039453
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| ||||||| | ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
49039539 |
tgagcatagctcagttggcagggacatgcattgttatatgcagggactggggttcgaaccccggacaccccacttattcaccttgaa |
49039453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 9692953 - 9693041
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||| | ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9692953 |
ttgtccccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
9693041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 14149784 - 14149872
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||| ||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14149784 |
ttgtccccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
14149872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 53815696 - 53815775
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
53815696 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattc |
53815775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 36257695 - 36257773
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| || ||| | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36257695 |
tgagcatagctcagttggcagggacaagcagtattgtatgcaggggccggggttcgaaccccggacaccccacttattc |
36257773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 144 - 242
Target Start/End: Original strand, 49743364 - 49743461
Alignment:
| Q |
144 |
gagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaattt |
242 |
Q |
| |
|
|||||||| || ||||||||||| |||| | ||||| ||||||||||||| ||||||| ||||||||| |||||||| ||||||| | |||||||||| |
|
|
| T |
49743364 |
gagcatagttcagttggcagggatatgcattattatatgcaggggccgggattcgaaccccggacacctcacttatttaccttgaa-aaaggtgaattt |
49743461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 56531331 - 56531254
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||||||| || ||||||| ||||| ||| | |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56531331 |
tgagcatagctcagttggcaaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccacttat |
56531254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 9084750 - 9084838
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggac-atgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||| | |||| |||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
9084750 |
ttgtctccatgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattc |
9084838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 36008275 - 36008359
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | |||| ||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
36008275 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcacctt |
36008359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 52330965 - 52330925
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52330965 |
tgcaggggccggggttcgaactccggacaccccacttattc |
52330925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 8690214 - 8690293
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||| ||||| ||| | ||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
8690214 |
tgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
8690293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 47018008 - 47017957
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
47018008 |
attatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
47017957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 56954 - 56868
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| || |||||||||||||||| | |||| |||| ||||||| |||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
56954 |
tgagcataactcagttggcagggacatgcattgttatatgcaagggccggagttcgaactccgaacaccccatttattcaccttgaa |
56868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 20166317 - 20166403
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| ||| || |||||||||||||||| | |||| ||||||||||| ||||||||| || || ||||||||||||| ||||||| |
|
|
| T |
20166317 |
tgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttattctccttgaa |
20166403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 27921897 - 27921975
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||| |||||||||| | ||||| ||||||||||||||||||||| || |||| | ||||||||| |
|
|
| T |
27921897 |
tgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaaccccagacatctcacttattc |
27921975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 175 - 220
Target Start/End: Complemental strand, 53698042 - 53697997
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53698042 |
attatatgcaggggccggggttcgaaccccggacaccccacttatt |
53697997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 22096447 - 22096407
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22096447 |
tgcaggggccgaggttcgaactccggacaccccacttattc |
22096407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 33076533 - 33076614
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| ||||||||| | ||||| |||||||| |||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
33076533 |
tgagcatagctcagttgg--gggacatgcattattatatgcaggggtcggggttcgaaccccggacaccctacttattcacctt |
33076614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 3465616 - 3465667
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
3465616 |
attatatgcaggggccggagttcgaaccccggacaccccacttattcacctt |
3465667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 20753219 - 20753136
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| ||| | |||| | ||||| || |||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
20753219 |
tgagcatagctcagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttattcacctt |
20753136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 38690699 - 38690750
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
38690699 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
38690750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 42758257 - 42758175
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||| | |||||||||| | ||||| ||||||||||||| ||||||| | ||||||||||||||||| |||| |
|
|
| T |
42758257 |
tgagcatagctcagtttgtagggacatgcattattatatgcaggggccggg-ttcgaaccctggacaccccacttattcacctt |
42758175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 217
Target Start/End: Original strand, 51890801 - 51890875
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||| || |||||||||||||| || ||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51890801 |
tgagcttagctcagttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
51890875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 53355022 - 53354983
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53355022 |
tgcaggggccggggttcgaaccccggacaccccacttatt |
53354983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 7768850 - 7768804
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7768850 |
attatatgcagaggccggggttcgaaccccggacaccccacttattc |
7768804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 8965130 - 8965172
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8965130 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
8965172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 10098158 - 10098204
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
10098158 |
attatatgcaggggccgggattcgaaccccggacaccccacttattc |
10098204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 21935513 - 21935555
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21935513 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
21935555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 24234136 - 24234090
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24234136 |
attatatgcaggggccggggtttgaaccccggacaccccacttattc |
24234090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 29785151 - 29785237
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||| | | || || |||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
29785151 |
tgagcatagctcagttggcagggacatacactgtaatatgtaggggctggggttcgaaccccggacaccccacttattcaccttgaa |
29785237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 36954150 - 36954216
Alignment:
| Q |
156 |
gttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||| ||| | ||||| |||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
36954150 |
gttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattc |
36954216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 42395263 - 42395305
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
42395263 |
attatatgtaggggccggggttcgaactccggacaccccactt |
42395305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 133 - 226
Target Start/End: Original strand, 48512189 - 48512283
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| || ||||||||| || ||||||||||||| ||| | |||| ||||||||| ||||||| || ||||||||||||||||||| |||| |
|
|
| T |
48512189 |
attgtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcacctt |
48512283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 2222576 - 2222617
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2222576 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
2222617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 6930593 - 6930638
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
6930593 |
tgcaggggccgggattcaaactccggacaccccacttattcacctt |
6930638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 11294890 - 11294830
Alignment:
| Q |
157 |
ttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||| || ||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11294890 |
ttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
11294830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 21200564 - 21200609
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
21200564 |
ttatatgcaggggtcggggttcgaactccggtcaccccacttattc |
21200609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 35747538 - 35747493
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
35747538 |
tgcaggggtcgaggttcgaactccggacaccccacttattcacctt |
35747493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 36099216 - 36099175
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36099216 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
36099175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 9924889 - 9924941
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
9924889 |
attatatgcaggggtcggggttcgaaccccggacactccacttattcaccttg |
9924941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 11491275 - 11491235
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
11491275 |
tgcaggggccggagttcgaaccccggacaccccacttattc |
11491235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 27862887 - 27862847
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
27862887 |
tgcaggggctggggttcgaaccccggacaccccacttattc |
27862847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 29584685 - 29584733
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
29584685 |
tgcaggggccgaggttcgaaccccggacacctcacttattctccttgaa |
29584733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 37728940 - 37729012
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccac |
215 |
Q |
| |
|
||||||||| || ||||| ||||| |||| | ||||| |||||||| || |||||||||||||||||| |||| |
|
|
| T |
37728940 |
tgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaactccggacactccac |
37729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 46283161 - 46283201
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46283161 |
tgcagcggccggggttcgaaccccggacaccccacttattc |
46283201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 50815746 - 50815786
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
50815746 |
tgcaggggccggggttcgaaccccggacaccccacatattc |
50815786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 18497413 - 18497476
Alignment:
| Q |
163 |
gggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| | |||| |||||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
18497413 |
gggacatgcattgttatatgcaggggttggggttcgaactccggacatcccacttattctcctt |
18497476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 31601839 - 31601890
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||| | ||||||| ||||||||||||||||||| |||| |
|
|
| T |
31601839 |
attatatgcaggggccgagattcgaaccccggacaccccacttattcacctt |
31601890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 37032241 - 37032190
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
37032241 |
attatatgcaggggtcgggattcgaaccccggacaccccacttattcacctt |
37032190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 221
Target Start/End: Original strand, 37274624 - 37274659
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37274624 |
gggccggggttcgaaccccggacaccccacttattc |
37274659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 40150473 - 40150552
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||| ||| ||| | ||||| | |||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
40150473 |
tgagcatagttcagttggcaggaacaatgcattattatatacaggggtcggggttcgaaccccggacacctcacttattc |
40150552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 3036089 - 3036047
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3036089 |
attatatgcaggggccgaggttcgaaccccggacaccccactt |
3036047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 6481665 - 6481595
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||| | ||||| ||||| ||||| ||||||||| | ||| |||||||||||| |||| |
|
|
| T |
6481665 |
gttggcagggacatgcatgattatatgcagaggccgaggttcgaacctcagacgccccacttattcacctt |
6481595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 11375923 - 11375881
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
11375923 |
attatatgcaggggccggggttcgaaccccggacacctcactt |
11375881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 13578499 - 13578457
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
13578499 |
attatatgcaggggtcggggttcgaaccccggacaccccactt |
13578457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 15185079 - 15185165
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| |||||||||||||| |||| | |||| |||||||| ||||||| ||| | |||||||| ||| |||| ||||||| |
|
|
| T |
15185079 |
tgagcatagttcggttggcagggatatgcattgttatatgcaggggtcggggtttgaatcctggacaccctactcattctccttgaa |
15185165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 34773745 - 34773699
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
34773745 |
attatatgcaggggctgaggttcgaaccccggacaccccacttattc |
34773699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 34974743 - 34974785
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34974743 |
aggggctggggttcgaaccccggacaccccacttattctcctt |
34974785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 37889668 - 37889622
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
37889668 |
attatatgcaggggtcggggttcgaaccccggacacctcacttattc |
37889622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 37997927 - 37997857
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||| | | |||| ||||||| | ||||||||||| || |||||||||||||||| |||| |
|
|
| T |
37997927 |
gttggcagggacattcattgttatatgcagggtctggggttcgaaccccagacaccccacttattcacctt |
37997857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 42134491 - 42134449
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
42134491 |
attatatgcaagggtcggggttcgaactccggacaccccactt |
42134449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 43362222 - 43362184
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
43362222 |
caggggtcggggttcgaaccccggacaccccacttattc |
43362184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 217
Target Start/End: Complemental strand, 47094190 - 47094156
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
47094190 |
caggggccggggttcgaactccggacactccactt |
47094156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 47934106 - 47934064
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
47934106 |
attatatgcaggggccggggttcgaaccccggacactccactt |
47934064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 213
Target Start/End: Original strand, 49901518 - 49901556
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacacccc |
213 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
49901518 |
attatatgcaggggccggggttcgaaccccggacacccc |
49901556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 56546511 - 56546465
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
56546511 |
attatatgcaggggccggggttcgaaccacagacaccccacttattc |
56546465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 226
Target Start/End: Original strand, 3442886 - 3442927
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
3442886 |
ggggccggggttcgaaccccagacaccccacttattcacctt |
3442927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 15853815 - 15853900
Alignment:
| Q |
135 |
tgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||||| | |||| | ||||||| ||||||||||| | |||||||||| ||||| |
|
|
| T |
15853815 |
tgtctccgtgagcataattcagttggcaggaacatgcattgttatatacaggggctggggttcgaaccctggacaccccagttatt |
15853900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 17617013 - 17616972
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
17617013 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
17616972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 18360530 - 18360571
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18360530 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
18360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 220
Target Start/End: Complemental strand, 26885462 - 26885417
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
26885462 |
attatatgctggggccggggttcgaaccccggacactccacttatt |
26885417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 28715727 - 28715768
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
28715727 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
28715768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 36602399 - 36602358
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
36602399 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
36602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 37574311 - 37574356
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||| ||| |||| |||||||||||||| |||| |
|
|
| T |
37574311 |
tgcaggggccggggttcaaaccccgggcaccccacttattcacctt |
37574356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 40407017 - 40406976
Alignment:
| Q |
181 |
tgcaggggccgggg-ttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
40407017 |
tgcaggggccgggggttcgaaccccggacaccccacttattc |
40406976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 221
Target Start/End: Complemental strand, 41272023 - 41271994
Alignment:
| Q |
192 |
gggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41272023 |
gggttcgaactccggacaccccacttattc |
41271994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 226
Target Start/End: Original strand, 43143771 - 43143804
Alignment:
| Q |
193 |
ggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
43143771 |
ggttcgaactccggacaccccacttattcacctt |
43143804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 56087987 - 56087946
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
56087987 |
ttatatgcaggggccggggttcgaatcccggacaccccactt |
56087946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 12820500 - 12820416
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || |||||||| |||| ||| | |||| |||||||| ||||||| |||| | ||||||||||||||||| |||| |
|
|
| T |
12820500 |
tgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcacctt |
12820416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 16556490 - 16556530
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
16556490 |
tgcaggggtcggggttcgaaccccgaacaccccacttattc |
16556530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 29406399 - 29406435
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
29406399 |
tgcaggggtcggggttcgaactccggacaacccactt |
29406435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 38848148 - 38848112
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
38848148 |
tgcaggggtcggggttcgaaccccggacaccccactt |
38848112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 40486483 - 40486519
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40486483 |
tgcaggggccggggttcgaaccccggacactccactt |
40486519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 226
Target Start/End: Complemental strand, 41003215 - 41003183
Alignment:
| Q |
194 |
gttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
41003215 |
gttcgaactccggacaccccacttattcacctt |
41003183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 218
Target Start/End: Original strand, 42395600 - 42395632
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccactta |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
42395600 |
gggccggggttcgaaccccggacaccccactta |
42395632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 42432022 - 42432086
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
|||||||||||||||| | |||| ||||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
42432022 |
gttggcagggacatgcattgttatatgcagggattggggttcgaactccgaacaccctacttatt |
42432086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Complemental strand, 43323774 - 43323726
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| || ||||||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
43323774 |
tgcaggagctggggttcaaactccagacaccccacttattcaccttgaa |
43323726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 45139909 - 45139873
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
45139909 |
tgcaggggccggggttcgaaccccggacacctcactt |
45139873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 45847982 - 45847942
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
45847982 |
tgcagggatcggggttcgaaccccggacaccccacttattc |
45847942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 49264568 - 49264604
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
49264568 |
tgcaggggccgaggttcgaaccccggacaccccactt |
49264604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 52031246 - 52031286
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
52031246 |
tgcaggggtcggggttcgaaccccagacaccccacttattc |
52031286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 53468735 - 53468783
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
53468735 |
tgcaagggccggggttcgaaccccggacaccctacttatttaccttgaa |
53468783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 92)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 9624973 - 9625062
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| || ||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9624973 |
attgtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
9625062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 27183785 - 27183697
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27183785 |
ttgtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
27183697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 31108854 - 31108768
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||| ||||||||| ||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
31108854 |
tgagcataactcagttggcagggacatgcataattatatgcaggggctggggttcgaacccgagacaccccacttattcaccttgaa |
31108768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 14868685 - 14868764
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14868685 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattc |
14868764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 136 - 221
Target Start/End: Complemental strand, 36331828 - 36331742
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| ||||||||| || |||||||||||| ||| | ||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
36331828 |
gtctccgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
36331742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 10959133 - 10959212
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| | |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10959133 |
tgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattc |
10959212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 229
Target Start/End: Original strand, 24130551 - 24130646
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| || |||||||| || |||||||||||||| | | |||| |||||||| ||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
24130551 |
ttgtccccgtgagcataactcagttggcagggacatacattgttatatgcaggggacggggtttgaaccccggacaccccacttattcaccttgaa |
24130646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 24559389 - 24559468
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||| ||||||| | ||| ||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
24559389 |
tgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
24559468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 19137620 - 19137706
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||||||| |||||| | |||| ||||||||||| ||||||||| || ||||||||| |||||| ||||||| |
|
|
| T |
19137620 |
tgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaaccccagacaccccatttattctccttgaa |
19137706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 24537861 - 24537911
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
24537911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 42271074 - 42271024
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
42271074 |
ttatatgcaggggccggggttcgaactccggacaccctacttattcacctt |
42271024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 46328985 - 46328935
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
46328935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 3973296 - 3973389
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| ||||||||| || ||||| |||||||||| | |||| ||||||||||| | || |||| |||||||||||| |||||| ||||||| |
|
|
| T |
3973296 |
gtctccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcaccttgaa |
3973389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 3996580 - 3996487
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| ||||||||| || ||||| |||||||||| | |||| ||||||||||| | || |||| |||||||||||| |||||| ||||||| |
|
|
| T |
3996580 |
gtctccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcaccttgaa |
3996487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 16999942 - 17000007
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||| | ||||| || ||||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
16999942 |
gttggcagggacatgcattattatatgtaggggccggagttcgaactccagacaccccacatattc |
17000007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 28951860 - 28951953
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| |||||||| || |||||||| |||||| | ||||| |||||||| | |||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
28951860 |
gtctccgtgagcataactcagttggcagatacatgcattattatatgcaggggtcagggttcgaaccccgaacaccccacttattcaccttgaa |
28951953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 34407171 - 34407106
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
34407171 |
gttggcagggacatgcattattatatgcaggggttggggttcgaaccccagacaccccacttattc |
34407106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 11483652 - 11483692
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11483652 |
tgcaggggccagggttcgaactccggacaccccacttattc |
11483692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 221
Target Start/End: Original strand, 23237365 - 23237441
Alignment:
| Q |
145 |
agcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| || |||||||||||||||| | ||||| || ||||| ||| |||||||||||||||| ||||| ||||| |
|
|
| T |
23237365 |
agcatagctcagttggcagggacatgcattattatatgtaggggtcggagttcgaactccggacatcccacatattc |
23237441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 24751322 - 24751278
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24751322 |
attatatgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 29645883 - 29645843
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29645883 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
29645843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 229
Target Start/End: Complemental strand, 42665981 - 42665933
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42665981 |
tgcaggggtcggagttcgaactccggacaccccacttattcaccttgaa |
42665933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 47191373 - 47191457
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||| || |||||||| ||| ||||||||||||||| |||| |
|
|
| T |
47191373 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttattcacctt |
47191457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 221
Target Start/End: Original strand, 51017785 - 51017868
Alignment:
| Q |
137 |
tctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||| | |||| |||||| | ||| |||||||| ||||||||||||||||||| |
|
|
| T |
51017785 |
tctccatgagtatagctcagttggcagggacatgcattgttatatgcaggagtcggagttcgaac-ccggacaccccacttattc |
51017868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 16278045 - 16277962
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| ||| ||||| | ||||| |||||||| |||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
16278045 |
tgagcatagctcagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttattcacctt |
16277962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 214
Target Start/End: Complemental strand, 16874284 - 16874213
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacacccca |
214 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
16874284 |
tgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccgcggacacccca |
16874213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 217
Target Start/End: Original strand, 24303394 - 24303468
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||| || |||||||||||||| || ||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24303394 |
tgagcttagctcagttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
24303468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 226
Target Start/End: Complemental strand, 31902295 - 31902216
Alignment:
| Q |
147 |
catagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||| | | |||||||| | |||| || ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31902295 |
catagttcggtttgtatggacatgcatttttatatgtaggggtcggggttcgaactccggacaccccacttattcacctt |
31902216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 33206790 - 33206841
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
33206790 |
attatatgcaggggctggggttcgaaccccggacaccccacttattcacctt |
33206841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 40160736 - 40160819
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||||||||||||| | |||| ||| ||||| |||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
40160736 |
tgagcatagctcaattggcagggacatgcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctt |
40160819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 45713513 - 45713564
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
45713513 |
attatatgtaggggccggagttcgaactccggacaccccacttattcacctt |
45713564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 52030121 - 52030200
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || ||||||||||||| || | ||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
52030121 |
tgagcataactcagttggcagggacaatgtattattatatgcaggggccggggttcgaaccccggacaccctacttattc |
52030200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 4045728 - 4045650
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||| || |||| ||||||||||| | |||| |||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
4045728 |
tgagtatagttcagttgacagggacatgcattgttatatgcaggggtcgaggttcgaacttcggacaccccacttattc |
4045650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 7020775 - 7020853
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| ||||||| | ||||| | || ||| |||||||||||| |||| ||||| |||||||| |
|
|
| T |
7020775 |
tgagcatagatcagttggcagagacatgcattattatatacatgggtcggggttcgaaccccggtcacccaacttattc |
7020853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 19222639 - 19222578
Alignment:
| Q |
156 |
gttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||| || ||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19222639 |
gttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
19222578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 21249052 - 21248998
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| ||||||||||||||||||||| | | ||||||||||||||| ||||||| |
|
|
| T |
21249052 |
attatatgcaggggccggggttcgaaccctgaacaccccacttattcaccttgaa |
21248998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 34102645 - 34102603
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34102645 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
34102603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 39719971 - 39720013
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39719971 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
39720013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 41936441 - 41936399
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41936441 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
41936399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 49146117 - 49146163
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
49146117 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattc |
49146163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 53432771 - 53432729
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53432771 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
53432729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 2732702 - 2732747
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2732702 |
tgcaggggcaggggttcgaaccccggacaccccacttattcacctt |
2732747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 3784070 - 3784143
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccac |
215 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| | |||||| |||||||||||| ||||||||||||| |
|
|
| T |
3784070 |
tgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac |
3784143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 27329965 - 27329924
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27329965 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
27329924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 32256587 - 32256546
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32256587 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
32256546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 44625258 - 44625217
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44625258 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
44625217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 51879132 - 51879173
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51879132 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
51879173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 3955351 - 3955387
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3955351 |
ggggccggggttcgaaccccggacaccccacttattc |
3955387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 4227772 - 4227736
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4227772 |
tgcaggggtcggggttcgaactccggacaccccactt |
4227736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 26583120 - 26583180
Alignment:
| Q |
161 |
cagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||| | ||||| |||||||| ||||||||||||| |||||||| || |||||| |
|
|
| T |
26583120 |
cagggacatgcattattatatgcaggggtcggggttcgaactacggacacctcaattattc |
26583180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 29226365 - 29226405
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29226365 |
tgcaggggccggggttcgaaccccgtacaccccacttattc |
29226405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 43774185 - 43774269
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||| || ||||||||||||| ||| | |||| |||||||| |||||||||||| || |||||||||||||||| |||| |
|
|
| T |
43774185 |
tgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
43774269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 49639061 - 49639113
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| || |||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
49639061 |
attatatgtaggggccggggttcgaaccccgaacaccccacttattcaccttg |
49639113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 221
Target Start/End: Complemental strand, 51412082 - 51412006
Alignment:
| Q |
145 |
agcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| || |||||||||||||||| | |||| |||||| | ||||||||||| ||||| ||||||||||||| |
|
|
| T |
51412082 |
agcatagttcagttggcagggacatgcattgttatatgcaggagtcggggttcgaatcccggataccccacttattc |
51412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 9167333 - 9167282
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| ||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
9167333 |
attatatgcaggggtcggggttcgaacttcggacaccccagttattcacctt |
9167282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 14417901 - 14417952
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| || |||||||| ||||||||||||||||||| |||| |
|
|
| T |
14417901 |
attatatgcaggggctggagttcgaaccccggacaccccacttattcacctt |
14417952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 27066643 - 27066694
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| | |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27066643 |
attatatgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
27066694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 32508856 - 32508805
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
32508856 |
attatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctt |
32508805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 35483302 - 35483353
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35483302 |
attatatgcaggggtcggggttcgaatcccggacaccccacttattcacctt |
35483353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 3894580 - 3894622
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3894580 |
attatatgcaggagccggggttcgaactccggacactccactt |
3894622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 4010112 - 4010026
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||| |||||||||| | |||| ||||||||||| ||| |||| ||| |||||||| |||||| ||||||| |
|
|
| T |
4010112 |
tgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcagtttgaaccccgaacaccccatttattcaccttgaa |
4010026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 23820662 - 23820708
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
23820662 |
attatatgcaggggccggagttcgaaccccagacaccccacttattc |
23820708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 24160622 - 24160544
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || |||||||| ||||||| |||| |||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
24160622 |
tgagcataactcagttggcagagacatgcactgttatatgcaggggtcggggttcgaaccccggacactccacttattc |
24160544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 27394541 - 27394591
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||| |||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
27394541 |
ttatatgcaggggctggggtttgaaccccggacaccccacttattcacctt |
27394591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 32665314 - 32665360
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32665314 |
attatatgcaagggtcggggttcaaactccggacaccccacttattc |
32665360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 36476392 - 36476438
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
36476392 |
attatatgcaggggccggagttcgaaccccgaacaccccacttattc |
36476438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 53163630 - 53163672
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
53163630 |
attatatgtaggggccggggttcgaaccccggacaccccactt |
53163672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 166827 - 166872
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| |||| |
|
|
| T |
166827 |
tgcaggggccggggttcgaaccccagacacctcacttattcacctt |
166872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 229
Target Start/End: Complemental strand, 11668318 - 11668277
Alignment:
| Q |
188 |
gccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
11668318 |
gccggggttcgaaccacggacaccccacttattcaccttgaa |
11668277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 19879238 - 19879279
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
19879238 |
ttatatgcaggggccggggttcgaaccccgaacaccccactt |
19879279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 22432972 - 22432927
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
22432972 |
ttatatgcaggggccggggttcaaaccccggacactccacttattc |
22432927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 32732570 - 32732529
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
32732570 |
ttatatgcaggggtcggggttcgaactccggacactccactt |
32732529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 34847579 - 34847616
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccc |
212 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34847579 |
attatatgcaggggtcggggttcgaactccggacaccc |
34847616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 37488493 - 37488452
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
37488493 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
37488452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 43280086 - 43280146
Alignment:
| Q |
157 |
ttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||| || ||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43280086 |
ttggcagggacattgcataatt-tatgcaggggccggggttcgaatcccggacaccccactt |
43280146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 45431666 - 45431711
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
45431666 |
tgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
45431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 228
Target Start/End: Complemental strand, 49299333 - 49299249
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttga |
228 |
Q |
| |
|
||||||||| || |||| ||||||||||| ||||||| || | ||| ||||||||||| || ||||| |||||||||| |||||| |
|
|
| T |
49299333 |
tgagcatagttcagttgacagggacatgcataattatatgtaaaggctggggttcgaac-ccagacactccacttattcaccttga |
49299249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 49429499 - 49429544
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
49429499 |
tgcagggaccagggttcgaaccccggacaccccacttattcacctt |
49429544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 49443475 - 49443415
Alignment:
| Q |
157 |
ttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||| || ||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
49443475 |
ttggcagggacattgcataatt-tatgcaggggccggagttcgaaccccggacaccccactt |
49443415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 50659627 - 50659668
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
50659627 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
50659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 54983761 - 54983716
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
54983761 |
tgcaggggtcggggttcgaaccccggacaccccatttattcacctt |
54983716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 3993801 - 3993725
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||||||| || |||| |||||||||| | |||| ||||||||||| |||| |||| |||||||||||| |||| |
|
|
| T |
3993801 |
tgagcatagctcagttgagagggacatgcattgttatatgcaggggccgcggtttgaaccccggacaccccatttat |
3993725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 17262258 - 17262306
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
17262258 |
tgcaggggctgaggttcgaatcccggacaccccacttattcaccttgaa |
17262306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 24136808 - 24136768
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
24136808 |
tgcaggggccagggatcgaaccccggacaccccacttattc |
24136768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 25884016 - 25883980
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
25884016 |
tgcaggggtcggggttcgaaccccggacaccccactt |
25883980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 32776253 - 32776289
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
32776253 |
tgcaggggccggggttcgaaccccggacacctcactt |
32776289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 33528261 - 33528221
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
33528261 |
tgcaggggctggggttcgaaccccagacaccccacttattc |
33528221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 35477783 - 35477815
Alignment:
| Q |
194 |
gttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
35477783 |
gttcgaactccggacaccccacttattcacctt |
35477815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 38949716 - 38949752
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
38949716 |
tgcaggggccggggttcgaaccccgaacaccccactt |
38949752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 46798621 - 46798661
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
46798621 |
tgcaggggccgggattcgaaccctggacaccccacttattc |
46798661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 47864675 - 47864715
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
47864675 |
tgcaggggttggggttcgaaccccggacaccccacttattc |
47864715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 50381753 - 50381793
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
50381753 |
tgcaggggtcggggttcgaatcccggacaccccacttattc |
50381793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 87)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 145 - 229
Target Start/End: Original strand, 35195846 - 35195930
Alignment:
| Q |
145 |
agcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| || |||||||||||||||| | ||||| ||||||||||||||||||||| ||| |||||||| |||||| ||||||| |
|
|
| T |
35195846 |
agcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaaccccgaacaccccatttattcaccttgaa |
35195930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 218
Target Start/End: Original strand, 7465467 - 7465542
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccactta |
218 |
Q |
| |
|
||||||||| || |||||||| ||||||| | ||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7465467 |
tgagcatagctcagttggcagagacatgcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 21285448 - 21285364
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | |||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21285448 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
21285364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 133 - 229
Target Start/End: Original strand, 48174958 - 48175054
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||| || |||| |||| || ||||||| |||||||| | ||||| | |||||||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
48174958 |
attgtccccgtgagtatagctcagttggcaaggacatgcattattatatacaggggccggtgttcgaaccccggacaccccacttattccccttgaa |
48175054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 136 - 221
Target Start/End: Original strand, 32814821 - 32814906
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| ||||||||| || ||||| |||||||||| | ||||| |||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
32814821 |
gtctccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcgaatcccggacaccccacttattc |
32814906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 31475935 - 31475856
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||||||||||||| || | ||||| ||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
31475935 |
tgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattc |
31475856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 37665777 - 37665828
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
37665777 |
attatatgcaggggccggggttcaaaccccggacaccccacttattcgcctt |
37665828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 29658333 - 29658283
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29658333 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
29658283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 11808053 - 11808122
Alignment:
| Q |
157 |
ttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||||||||| | |||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11808053 |
ttggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11808122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 34891243 - 34891284
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891243 |
ttatatgcaggggccggggttcgaactccggacaccccactt |
34891284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 41417380 - 41417291
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| || ||||||||| || ||||||||| ||| ||| | ||||| |||||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
41417380 |
attgtccccgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttattc |
41417291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 40273860 - 40273900
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40273860 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
40273900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Complemental strand, 44437887 - 44437843
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44437887 |
attatatgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 14102494 - 14102545
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
14102494 |
attatatgcaggggccggggtttgaaccccggacaccccacttattcacctt |
14102545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 14412511 - 14412562
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
14412511 |
attatatgcaggggccggggtttgaaccccggacaccccacttattcacctt |
14412562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 36316036 - 36315985
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
36316036 |
attatatgcaggggccggggttcgaacctcggacaccccacttattcacctt |
36315985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 38451863 - 38451942
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||| |||||||| ||| | |||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38451863 |
tgagcatagctcagttgacagggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattc |
38451942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 1513488 - 1513574
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| ||| |||||||||||||||| | |||| || ||||| | ||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
1513488 |
tgagcataaatcagttggcagggacatgcattgttatatgtaggggttgaggttcgaacaccgaacaccccacttattcaccttgaa |
1513574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 1563773 - 1563731
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1563773 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
1563731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 1649153 - 1649239
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||| ||||| |||| | || | |||||||||| |||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
1649153 |
tgagcatagctcagttggtagggatatgcattgttttatgcaggggccagggttcgaaccctggacaccccacttattcaccttgaa |
1649239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 9877301 - 9877259
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9877301 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
9877259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 20101686 - 20101644
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20101686 |
attatatgcaggggccggggttcgaactccggacaccctactt |
20101644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 23102592 - 23102550
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23102592 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
23102550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 23685616 - 23685570
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
23685616 |
attatatgcaggggccggggttcgaaccccagacaccccacttattc |
23685570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 33202608 - 33202570
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33202608 |
caggggccggggttcgaaccccggacaccccacttattc |
33202570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 226
Target Start/End: Complemental strand, 37410582 - 37410492
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| ||||||||| || ||||| | |||||||| | |||| |||||||| | ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
37410582 |
gtctccgtgagcatagctcagttggtaaggacatgcattgttatatgcaggggtcaaggttcgaactccggacacctcacttattctcctt |
37410492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 44409202 - 44409287
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| || ||| |||||||||||| | ||||| |||| ||| |||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
44409202 |
tgagcataactcagttagcagggacatgcattattatatgcaagggtcggggttcgaac-ccgaacaccccacttattcaccttgaa |
44409287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 47880179 - 47880225
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47880179 |
attatatgcaggggccggggttcgaatcccggacaccccacttattc |
47880225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 229
Target Start/End: Complemental strand, 2567893 - 2567840
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||||||||||||| ||||||| |
|
|
| T |
2567893 |
ttatatgcaggggccggggttcgaaccccggtcaccccacttattaaccttgaa |
2567840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 38032936 - 38032875
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||| | |||| | ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38032936 |
gttggcagggacatgcattgttatatacaggggccggggttcgaaccccggacacctcactt |
38032875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 4169076 - 4169160
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||||||||||| || | |||| |||| ||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
4169076 |
tgagcatagctcagttggcagggacaatgtattgttatatgcaagggccggggtttgaaccccggacaccccacttattcacctt |
4169160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 14818469 - 14818381
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | ||||| |||||||| |||||||| ||| || ||||||||||||||| |
|
|
| T |
14818469 |
ttgtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattc |
14818381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 15265467 - 15265379
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | ||||| |||||||| |||||||| ||| || ||||||||||||||| |
|
|
| T |
15265467 |
ttgtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattc |
15265379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 27047810 - 27047726
Alignment:
| Q |
142 |
atgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||| || ||||| ||| |||| | ||||| ||||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
27047810 |
atgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccatttattcacctt |
27047726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 27726459 - 27726383
Alignment:
| Q |
147 |
catagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgc |
223 |
Q |
| |
|
||||| || |||||||||||||||| | ||||| |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
27726459 |
catagctcagttggcagggacatgcattattataagcagtggccggggttcgaacctcggacaccctgcttattcgc |
27726383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 28914929 - 28914893
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28914929 |
ggggccggggttcgaaccccggacaccccacttattc |
28914893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 31793507 - 31793547
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31793507 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
31793547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 38378258 - 38378298
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
38378258 |
tgcaggggccggggtttgaaccccggacaccccacttattc |
38378298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 46645746 - 46645786
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46645746 |
ttatatgcaggggccggggttcgaaccccggacaccccact |
46645786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 46758279 - 46758319
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46758279 |
ttatatgcaggggtcggggttcgaactccggacaccccact |
46758319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 48433766 - 48433726
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
48433766 |
tgcaggggccggggttcaaaccccggacaccccacttattc |
48433726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 2261546 - 2261495
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
2261546 |
attatatgcaggggccggggttcgaatcccggacacccaacttattcacctt |
2261495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 2366390 - 2366441
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
2366390 |
attatatgcaggggtcggggttcgaactctagacaccccacttattcacctt |
2366441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 17900941 - 17900890
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||| |||||||||||| |||| |
|
|
| T |
17900941 |
attatatgcaggggccggggctcgaaccccggactccccacttattctcctt |
17900890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 22706090 - 22706039
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| | ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
22706090 |
attatatgcaggggctgaggttcaaactccggacaccccacttattcacctt |
22706039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 22966020 - 22965969
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||| || |||||||||||||||| |||| |
|
|
| T |
22966020 |
attatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
22965969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 30644202 - 30644253
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| || |||||||||||||||| |||| |
|
|
| T |
30644202 |
attatatgcaggggccggtgttcgaaccccagacaccccacttattcacctt |
30644253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 220
Target Start/End: Complemental strand, 34961024 - 34960937
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||||| |||||| || ||||||| | ||| ||| | ||||| |||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
34961024 |
ttgtctccatgggcatagctcagttggcatgaacaatgcattattatatgcaggagccggggttcgaatcccggacaccacacttatt |
34960937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 41139087 - 41139166
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| |||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
41139087 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattc |
41139166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 41331145 - 41331071
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||| || |||||||||||||| || ||||| | |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
41331145 |
tgagcttagctcagttggcagggacattgcataatt-tatgcaggggtcggggttcgaattccggacaccccactt |
41331071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 217
Target Start/End: Complemental strand, 41833019 - 41832976
Alignment:
| Q |
174 |
aattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
41833019 |
aattatatgcaggggccggggttcgaaccctggacaccccactt |
41832976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 43635589 - 43635672
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| || |||||||| |||||| | |||| ||||| || |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
43635589 |
tgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcgaaccccggacaccccacttattcacctt |
43635672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 216
Target Start/End: Complemental strand, 44662519 - 44662484
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44662519 |
tgcaggggccggggttcgaaccccggacaccccact |
44662484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 47552246 - 47552297
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||| |||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
47552246 |
attatatgcaagggccggggttcgaaccccggacaccctacttattcacctt |
47552297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 1398937 - 1398895
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1398937 |
attatatgcaggggccggggttcgaatcccggacaccccactt |
1398895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 216
Target Start/End: Complemental strand, 6548763 - 6548733
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6548763 |
gggccggggttcgaactccggacaccccact |
6548733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 9712232 - 9712190
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
9712232 |
attatatgcaggggtcggggttcgaaccccggacaccccactt |
9712190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 14707326 - 14707376
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14707326 |
ttatatgcaggggttggggttcgaaccccggacaccccacttattcacctt |
14707376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 15238925 - 15238967
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15238925 |
attatatgcaggggccggggttcgaaccccggacactccactt |
15238967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 15716719 - 15716673
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15716719 |
attatatgcaagggtcggggttcgaacttcggacaccccacttattc |
15716673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 24304345 - 24304299
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
24304345 |
attatatgcaggggtcggggttcgaactccgaacaccccatttattc |
24304299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 25711193 - 25711147
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25711193 |
attatatgtaggggccggggttcgaacctcggacaccccacttattc |
25711147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 217
Target Start/End: Original strand, 36931990 - 36932051
Alignment:
| Q |
156 |
gttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||| || ||||| | ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
36931990 |
gttggcagggacattgcataatt-tatgcagggtccggggttcgaaccccggacaccccactt |
36932051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 41465870 - 41465912
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
41465870 |
attatatgcaggggtcagggttcgaactccggacaccccactt |
41465912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 5228109 - 5228154
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
5228109 |
tgcaggggccggggttcgaatcctggacaccccacttattcacctt |
5228154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 23799314 - 23799379
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||||||| | |||| |||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
23799314 |
gttggcagagacatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattc |
23799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 27788271 - 27788347
Alignment:
| Q |
141 |
catgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| || |||||||||| || || ||||| | ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
27788271 |
catgagcatagctcaattggcagggatattgcataatt-tatgcaggggccggggttcgaaccccagacaccccactt |
27788347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 27791427 - 27791503
Alignment:
| Q |
141 |
catgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| || |||||||||| || || ||||| | ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
27791427 |
catgagcatagctcaattggcagggatattgcataatt-tatgcaggggccggggttcgaaccccagacaccccactt |
27791503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 31694103 - 31694148
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| |||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
31694103 |
attatatgcaggggacgagattcgaactccggacaccccacttatt |
31694148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 32047126 - 32047167
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
32047126 |
ttatatgcaggggccggggttcgaaccccggacacctcactt |
32047167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 34259698 - 34259735
Alignment:
| Q |
182 |
gcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
34259698 |
gcaggggccggagttcgaactccgaacaccccacttat |
34259735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 34948145 - 34948190
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34948145 |
tgcagtggccgaggttcgaaccccggacaccccacttattcacctt |
34948190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 35498412 - 35498476
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||| ||| ||| |||| |||||||||||||||||| |
|
|
| T |
35498412 |
gttggcagggacatgcattattatatgcaggggttggg-ttcaaacttcggacaccccacttattc |
35498476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 35683160 - 35683119
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
35683160 |
ttatatgcaggggtcggggttcgaactccggacactccactt |
35683119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 42182232 - 42182191
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
42182232 |
attatatgcaggggtcggggttcgaactccggacactccact |
42182191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 42887187 - 42887232
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| ||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
42887187 |
attatatgcaggggctgaggttcgaaccccggacaccccacttatt |
42887232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 47355843 - 47355888
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
47355843 |
ttatatgcaggggccggggttcgaaccccagacatcccacttattc |
47355888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 3889852 - 3889816
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3889852 |
ggggccagggttcgaaccccggacaccccacttattc |
3889816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 3961464 - 3961424
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
3961464 |
tgcagaggccggggttcgaaccccggacatcccacttattc |
3961424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 4956148 - 4956108
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
4956148 |
tgcaggggtcggggttcgaaccctggacaccccacttattc |
4956108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 12166121 - 12166161
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
12166121 |
tgcaggggctggggttcgaaccccagacaccccacttattc |
12166161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 13702062 - 13702102
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13702062 |
ttatatgcaggggccggggttcaaaccccggacaccccact |
13702102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 30566503 - 30566571
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggac-atgcgtaattatttgcaggggccggggttcgaactccggacac |
210 |
Q |
| |
|
||||||||| ||||||||||||||| |||| | |||| || | |||||||||||||||| |||||||| |
|
|
| T |
30566503 |
tgagcatagctcggttggcagggacaatgcattgttatatgtaagggccggggttcgaaccccggacac |
30566571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 36389699 - 36389663
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccc |
212 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
36389699 |
ttatatgcaggggccggagttcgaactccggacaccc |
36389663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 241
Target Start/End: Complemental strand, 41012685 - 41012577
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatag |
232 |
Q |
| |
|
|||||||| ||||||||| || |||| |||||||||| | |||| || ||||||||| | |||||| ||| ||| ||||||||||| |||| || | |
|
|
| T |
41012685 |
attgtctctgtgagcatagctcaattggtagggacatgcattgttatatgtaggggccggagctcgaaccccgaacatcccacttattcaccttaaaaaa |
41012586 |
T |
 |
| Q |
233 |
aggtgaatt |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
41012585 |
aggtgaatt |
41012577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 229
Target Start/End: Complemental strand, 43712409 - 43712321
Alignment:
| Q |
141 |
catgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||| || ||||| |||||||||| | |||| | |||||| |||||||||||| |||| ||||||||||| | ||||||| |
|
|
| T |
43712409 |
catgagcataactcagttggtagggacatgcattgttatatacaggggtcggggttcgaacctcggataccccacttatcctccttgaa |
43712321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 45284847 - 45284811
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
45284847 |
tgcaggggtcggggttcgaaccccggacaccccactt |
45284811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 34136 - 34049
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || |||||||||||||||| | |||| |||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
34136 |
ttgtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaattccggacactccacttattc |
34049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 85)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 2800019 - 2800098
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2800019 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
2800098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 221
Target Start/End: Original strand, 14012603 - 14012691
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || ||||||||||||| ||| | |||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14012603 |
ttgtccccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttattc |
14012691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 2696533 - 2696612
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2696533 |
tgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
2696612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 4798603 - 4798551
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
4798603 |
attatatgcaggggccggggttcgaaccccggacaccccacttattcaccttg |
4798551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 1588767 - 1588846
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| | ||||||||||||| ||| | ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1588767 |
tgagcatagcttagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattc |
1588846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 15042427 - 15042376
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
15042427 |
attatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
15042376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 14011132 - 14011054
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| |||||||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
14011132 |
tgagcatagttcagttggcagggacatgcattgttatatgcaggggccggagttcgaacctcggacatcccacttattc |
14011054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 35301245 - 35301179
Alignment:
| Q |
156 |
gttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||| ||| | ||||| |||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
35301245 |
gttggcagggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttattc |
35301179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 17855688 - 17855728
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17855688 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
17855728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 17980315 - 17980359
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17980315 |
attatatgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 41454883 - 41454843
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41454883 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
41454843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 7345429 - 7345512
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| || |||||||||||||||| | ||||| |||||||| |||| ||| |||||| ||||||||||||||| |||| |
|
|
| T |
7345429 |
tgagcataactcagttggcagggacatgcattattatatgcaggggtcgggcttccaactccaaacaccccacttattcacctt |
7345512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 26657857 - 26657944
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggaca-ccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||| |||||||||| | |||| ||||||| ||||||||||||| || |||| |||||||||||| ||||||| |
|
|
| T |
26657857 |
tgagcatagctcagttggtagggacatgcattgttatatgcagggaccggggttcgaaccccagacacccccacttattcaccttgaa |
26657944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 220456 - 220370
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| |||| ||||| || | ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
220456 |
tgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaa |
220370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 689611 - 689525
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| |||| ||||| || | ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
689611 |
tgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaa |
689525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 734079 - 733993
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| |||| ||||| || | ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
734079 |
tgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaa |
733993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 229
Target Start/End: Complemental strand, 857975 - 857889
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||||| |||| ||||| || | ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
857975 |
tgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaa |
857889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 7314766 - 7314812
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
7314766 |
attatatgcaggggccgaggttcgaaccccggacaccccacttattc |
7314812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 17467311 - 17467364
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
17467311 |
attatatgcaggggccggg-ttcgaaccccggacaccccacttattcaccttgaa |
17467364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 34894405 - 34894447
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34894405 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
34894447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 39484432 - 39484386
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39484432 |
attatatgcaggggccggggttcgaatgccggacaccccacttattc |
39484386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 43468758 - 43468716
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43468758 |
aggggtcggggttcgaactccggacaccccacttattcacctt |
43468716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 136 - 201
Target Start/End: Complemental strand, 6372704 - 6372639
Alignment:
| Q |
136 |
gtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaac |
201 |
Q |
| |
|
|||||| |||| |||| || |||||||||||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
6372704 |
gtctccgtgaggatagctcagttggcagggacatgcataattatatgcagggggtggggttcgaac |
6372639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 217
Target Start/End: Original strand, 12770362 - 12770446
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||| |||||||| ||| || |||| |||||||| || ||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12770362 |
attgtccccatgagcttagctcagttgatagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
12770446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 14684269 - 14684232
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14684269 |
aggggccggggttcgaacttcggacaccccacttattc |
14684232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 241
Target Start/End: Original strand, 29653056 - 29653153
Alignment:
| Q |
144 |
gagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaatt |
241 |
Q |
| |
|
|||||||| || ||||||||||||||| | ||||| ||||||| || |||||||||||| | ||| |||||||||| |||| || | ||||||||| |
|
|
| T |
29653056 |
gagcatagttcaattggcagggacatgcattattatatgcagggatcgtggttcgaactcctgccactccacttattcaccttaaaaaaaggtgaatt |
29653153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 220
Target Start/End: Complemental strand, 30942661 - 30942616
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30942661 |
attatatgcaggggccggggttcgaaccccgaacaccccacttatt |
30942616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 38790677 - 38790588
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccgggg-ttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || |||||||| || ||||||||||||| ||| | ||||| |||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
38790677 |
ttgtccccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttattc |
38790588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 8349539 - 8349499
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
8349539 |
tgcaggggccggagttcgaactccgaacaccccacttattc |
8349499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 9737413 - 9737377
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9737413 |
aggggccgaggttcgaactccggacaccccacttatt |
9737377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 11231462 - 11231498
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11231462 |
tgcaggggccggggttcgaaccccggacaccccactt |
11231498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 43847735 - 43847779
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
43847735 |
attatatgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 45536757 - 45536797
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
45536757 |
tgcaggggccggagttcgaaccccggacaccccacttattc |
45536797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 5184949 - 5184898
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| ||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
5184949 |
attatatgcaggggctggggttcgaaccctggacaccccacttattcacctt |
5184898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 8034563 - 8034614
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||| |||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
8034563 |
attatatgcaggagccggggttcgaaccccgaacaccccacttattcacctt |
8034614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 9524990 - 9525041
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||||||| |||||||| |||| |
|
|
| T |
9524990 |
attatatgcaggggccggggttcgaaccccagacaccctacttattcacctt |
9525041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 10199804 - 10199753
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
10199804 |
attatatgcaggggccggggttcgaaccccaaacaccccacttattcacctt |
10199753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 10292352 - 10292431
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||| | | ||||||| |||||||||||||||||| |
|
|
| T |
10292352 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttattc |
10292431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 17987511 - 17987460
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||||| |||||| |||| |
|
|
| T |
17987511 |
attatatgcaggggccggagttcgaaccccggacaccccaattattcacctt |
17987460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 19957383 - 19957332
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| || ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19957383 |
attatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt |
19957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 24608545 - 24608494
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||||||| |||||||| |||| |
|
|
| T |
24608545 |
attatatgcaggggccggggttcgaaccccagacaccctacttattcacctt |
24608494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 222
Target Start/End: Original strand, 29937211 - 29937290
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcg |
222 |
Q |
| |
|
||||||||| || ||||| ||||||||| | |||| |||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
29937211 |
tgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttattcg |
29937290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 36359780 - 36359729
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
36359780 |
attatatgcaggggccggagttcgaatcccggacaccccacttattcacctt |
36359729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 39432431 - 39432344
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || |||||||||||||||| |||| |||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
39432431 |
ttgtccccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacctcagacaccccacttattc |
39432344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 2792815 - 2792857
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
2792815 |
attatatgcaggggccggggttcgaaccccggacactccactt |
2792857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 5328601 - 5328559
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
5328601 |
attatatgcaggggccggggttcgaaccccggacacctcactt |
5328559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 7763973 - 7763931
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7763973 |
attatatgcaggggccgggatttgaactccggacaccccactt |
7763931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 8034446 - 8034404
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
8034446 |
attatatgcaggggccggggttcgaacaccagacaccccactt |
8034404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 8740718 - 8740672
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
8740718 |
attatatgcaggggctgaggttcgaactccggacaccctacttattc |
8740672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 11823004 - 11823046
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
11823004 |
aggggccggggtttgaaccccggacaccccacttattcacctt |
11823046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 17072597 - 17072555
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
17072597 |
attatatgcaggggccggggttcgaaccccgaacaccccactt |
17072555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 17575674 - 17575716
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
17575674 |
attatatgcaggggccggggttcgaaccccgaacaccccactt |
17575716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 22274645 - 22274603
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22274645 |
attatatgcaggagccggggttcgaaccccggacaccccactt |
22274603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 23178925 - 23178883
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23178925 |
attatatgcaggggccggggttcgaaccccggacactccactt |
23178883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 31450991 - 31450949
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31450991 |
attatatgcaggagccggggttcgaactccggacactccactt |
31450949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 33524429 - 33524475
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
33524429 |
attatatgcagagaccggggttcgaaccccggacaccccacttattc |
33524475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 37290958 - 37291000
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
37290958 |
attatatgcaggggccggcgttcgaaccccggacaccccactt |
37291000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 42761927 - 42761881
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
42761927 |
attatatgcagggggcggggttcgaactctggacactccacttattc |
42761881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 43508501 - 43508459
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
43508501 |
aggggccggggtttgaaccccggacaccccacttattcacctt |
43508459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 44444580 - 44444622
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
44444580 |
attatatgcaggggctggggttcgaaccccggacaccccactt |
44444622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 574259 - 574311
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
574259 |
ttatatgcaggggtcggggttcgaaccccggaca-cccacttattcaccttgaa |
574311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 1360187 - 1360150
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
1360187 |
aggggctggggttcgaaccccggacaccccacttattc |
1360150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Original strand, 7453397 - 7453430
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
7453397 |
aggggccggggttcgaaccccggacaccccactt |
7453430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 33810677 - 33810718
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
33810677 |
ttatatgcaggggccggggttcaaaccccggacaccccactt |
33810718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 37708728 - 37708769
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
37708728 |
ttatatgcaggggccggggttcgaaccccggacatcccactt |
37708769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 43085256 - 43085215
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43085256 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
43085215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 43856415 - 43856374
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
43856415 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
43856374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 481053 - 481089
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
481053 |
tgcaggggccgcggttcgaaccccggacaccccactt |
481089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 1032609 - 1032649
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
1032609 |
tgcaggggctggggttcgaaccccagacaccccacttattc |
1032649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 2908119 - 2908083
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
2908119 |
tgcaggggccggggttcgaaccctggacaccccactt |
2908083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 4259898 - 4259938
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||| ||| |||||| |||||||||||| |
|
|
| T |
4259898 |
tgcaggggccggggttccaaccccggactccccacttattc |
4259938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 5904430 - 5904390
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
5904430 |
tgcaggggacggggttcgaaccccggacatcccacttattc |
5904390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 8350475 - 8350515
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
8350475 |
tgcaggggccggagttcgaacctcggacaccccacttattc |
8350515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 226
Target Start/End: Complemental strand, 14010819 - 14010783
Alignment:
| Q |
190 |
cggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14010819 |
cggggttcgaaccccggacaccccacttattcacctt |
14010783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 22652722 - 22652762
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
22652722 |
tgcaggggccggtgttcgaaccccggacaccccaattattc |
22652762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 22717833 - 22717869
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
22717833 |
tgcaggggccgaggttcgaaccccggacaccccactt |
22717869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 23139113 - 23139153
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
23139113 |
tgcaggggccgaggttcgaacaccagacaccccacttattc |
23139153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 25890432 - 25890396
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
25890432 |
tgcaagggccggggttcgaaccccggacaccccactt |
25890396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 31129345 - 31129381
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31129345 |
ggggtcggggttcgaaccccggacaccccacttattc |
31129381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 34812555 - 34812519
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
34812555 |
tgcaggggctggggttcgaaccccggacaccccactt |
34812519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 36103978 - 36103938
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
36103978 |
tgcaggggccggggttcgaaccccaaacaccccacttattc |
36103938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 38107502 - 38107466
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
38107502 |
tgcaggggccggggttcgaaccccagacaccccactt |
38107466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 38283166 - 38283202
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
38283166 |
tgcaggggccggggttcgaaccccagacaccccactt |
38283202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 38818832 - 38818872
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
38818832 |
ttatatgcaggggccggggttcgaactccggatactccact |
38818872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 44254388 - 44254320
Alignment:
| Q |
161 |
cagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||||| | ||||| ||| || | |||||||||||||| ||||| || |||||||| ||||||| |
|
|
| T |
44254388 |
cagggacatgcattattatatgcgggagtcggggttcgaactctggacatcctacttattcaccttgaa |
44254320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 67)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 1463871 - 1463950
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1463871 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
1463950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 3536030 - 3535947
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || |||||||||||||||| | |||| | |||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3536030 |
tgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttattcacctt |
3535947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 4674910 - 4674831
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||| |||||||| ||| | ||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
4674910 |
tgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
4674831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 6447575 - 6447496
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6447575 |
tgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattc |
6447496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 20945953 - 20945902
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
20945953 |
attatatgcaggggccggggttcgaaatccggacaccccacttattcacctt |
20945902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 10943749 - 10943795
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10943749 |
attatatgcaggggccggggttcgaaccccggacaccccacttattc |
10943795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 25660913 - 25660991
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||| |||| | |||| ||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
25660913 |
tgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttattc |
25660991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 27006341 - 27006427
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || | |||||||| ||||| | |||| ||| |||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27006341 |
tgagcataggtcagatggcaggggcatgcattgttatatgctggggtcggggttcgaactccggacactccacttattcaccttgaa |
27006427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 8015874 - 8015919
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8015874 |
tgcaggggccggggttcgaaccccggacaccccacttattcacctt |
8015919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 229
Target Start/End: Original strand, 31556836 - 31556905
Alignment:
| Q |
160 |
gcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||| | |||| |||||||| ||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31556836 |
gcagggacatgcattgttatatgcaggggtcggagttcgaaccccggacaccccacttattcaccttgaa |
31556905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 38040264 - 38040344
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| || |||||||||||||||| | |||| |||||||| || |||||||||| |||||| ||||||||||| |
|
|
| T |
38040264 |
ccatgagcatagctcagttggcagggacatgcattgttatatgcaggggtcgaggttcgaact-cggacatcccacttattc |
38040344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 226
Target Start/End: Original strand, 40384274 - 40384335
Alignment:
| Q |
165 |
gacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||| | ||||| ||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40384274 |
gacatgcattattatatgcagcggctggggttcgaactccggacaccccacttattcacctt |
40384335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 31250186 - 31250226
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31250186 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
31250226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 38503313 - 38503273
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38503313 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
38503273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 43227905 - 43227945
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43227905 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
43227945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 18102043 - 18101960
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| ||||||| || |||||| | ||||| |||||||||||| |||||||| || |||||||||||||||| |||| |
|
|
| T |
18102043 |
tgagcatagctcggttgatagagacatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcacctt |
18101960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 20186867 - 20186951
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||| | || |||||||||||||||| | ||||| |||||||| ||||||| ||| || |||||||||||||||| ||||||| |
|
|
| T |
20186867 |
tgagcattgctcagttggcagggacatgcattattatatgcaggggtcggggtt--aaccccagacaccccacttattcaccttgaa |
20186951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 221
Target Start/End: Complemental strand, 20735266 - 20735191
Alignment:
| Q |
147 |
catagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||||||| ||| | ||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20735266 |
catagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttattc |
20735191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 32158476 - 32158425
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
32158476 |
attatatgcaggggccggggttcgaaccccgaacaccccacttattcacctt |
32158425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 33800926 - 33800977
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
33800926 |
attatatgcaggggccggggttcgaaccccagacaccccacttattcacctt |
33800977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 37303934 - 37304013
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| || | ||||| |||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
37303934 |
tgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttattc |
37304013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 38618743 - 38618692
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
38618743 |
attatatgcaagggccggggttcgaaccccggacaccccacttattcacctt |
38618692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 6614100 - 6614054
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6614100 |
attatatgcaggggccggggttcgaacctcggacaccccacttattc |
6614054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 13621980 - 13621938
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13621980 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
13621938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 226
Target Start/End: Original strand, 19608611 - 19608697
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||||| || |||| ||| | |||| | ||||| |||||||| ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19608611 |
ccatgagcatagctcagttgataggaatatgcattattatatgcaggggtcggggttcgaactccggacacttcacttattcacctt |
19608697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 36045196 - 36045150
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
36045196 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattc |
36045150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 10106632 - 10106709
Alignment:
| Q |
144 |
gagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || |||||||||||||| | | ||||| || ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
10106632 |
gagcatagctcagttggcagggacatccattattatatgtaggggccaaagttcgaaccccggacaccccacttattc |
10106709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 17891892 - 17891851
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17891892 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
17891851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 19059060 - 19059015
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
19059060 |
tgcaggggccggggttcgaaccctggacaccccacttattcacctt |
19059015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 28537169 - 28537214
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28537169 |
ttatatgcatgggccggggttcgaaccccggacaccccacttattc |
28537214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 42916426 - 42916467
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42916426 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
42916467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 5039719 - 5039759
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5039719 |
tgcaagggccggggttcgaacttcggacaccccacttattc |
5039759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 23937966 - 23937926
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23937966 |
ttatatgcaggggccggggttcgaaccccggacaccccact |
23937926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 843430 - 843379
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || ||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
843430 |
attatatgtaggggacggggttcgaaccccggacaccccacttattcacctt |
843379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 11246597 - 11246510
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||| || |||||||||||||||| | |||| |||||||| ||||| || ||| || |||| ||||||||||| |
|
|
| T |
11246597 |
ttgtcaccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaaccccagacatcccacttattc |
11246510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 226
Target Start/End: Complemental strand, 14230502 - 14230467
Alignment:
| Q |
191 |
ggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14230502 |
ggggttcgaactccggacaccccacttattctcctt |
14230467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 18478036 - 18478087
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
18478036 |
attatatgctggggccggggttcgaaccctggacaccccacttattcacctt |
18478087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 18872554 - 18872605
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
18872554 |
attatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctt |
18872605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 29050833 - 29050872
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacacccca |
214 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
29050833 |
attatatgcaggggccggggtttgaactccggacacccca |
29050872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 29096370 - 29096319
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||| ||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
29096370 |
attatatgcaagggccggagttcgaaccccggacaccccacttattcacctt |
29096319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 34729505 - 34729555
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34729505 |
attatatgcaggggtcggggttcgaac-ccggacaccccacttattcacctt |
34729555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 42455456 - 42455405
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||| |||||||||| |||| |
|
|
| T |
42455456 |
attatatgcaggggccggagttcgaaccccggacactccacttattcacctt |
42455405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 2411356 - 2411310
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
2411356 |
attatatgcaggggccggagttcgaaccccagacaccccacttattc |
2411310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 6558837 - 6558879
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
6558837 |
attatatgcaggggtcggggttcgaactccggacaccctactt |
6558879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 12891593 - 12891635
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
12891593 |
attatatgtaggggccggggttcgaaccccggacaccccactt |
12891635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 17545206 - 17545164
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
17545206 |
attatatgcaggggccggggttcgaaccccggacactccactt |
17545164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 226
Target Start/End: Original strand, 20191475 - 20191525
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
20191475 |
ttatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
20191525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 35813336 - 35813258
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||| ||||||||||| | |||| ||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
35813336 |
tgagcatagctcagttgacagggacatgcattgttatatgcaggggctcaggttcgaacccaggacaccccacttattc |
35813258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 41156364 - 41156406
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41156364 |
attatatgcaggagccggggttcgaactccggacactccactt |
41156406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 41539309 - 41539392
Alignment:
| Q |
135 |
tgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
|||||| |||||||||| || ||||| ||||||||| ||||||| |||||||| | |||||||| || ||||||||||||||| |
|
|
| T |
41539309 |
tgtctctatgagcatagctcagttgg--gggacatgcataattatatgcaggggttgtagttcgaaccccagacaccccacttatt |
41539392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 42801503 - 42801457
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
42801503 |
attatatgcaggggtcggggttcgaaccccggacacctcacttattc |
42801457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 962322 - 962367
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
962322 |
ttatatgcaggggttggggttcgaactccggacaccctacttattc |
962367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 220
Target Start/End: Complemental strand, 973030 - 972993
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
973030 |
caggggccggggttcgaaccccggaccccccacttatt |
972993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 3740991 - 3741032
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3740991 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
3741032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 18638635 - 18638676
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18638635 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
18638676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 24033114 - 24033155
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24033114 |
ttatatgcaggggccggggttcgaaccccggacacgccactt |
24033155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 25346218 - 25346263
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
25346218 |
ttatatgcaggggccggggttcgaatcccggacaccccacgtattc |
25346263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 212
Target Start/End: Complemental strand, 33433945 - 33433916
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33433945 |
caggggccggggttcgaactccggacaccc |
33433916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 229
Target Start/End: Complemental strand, 38129074 - 38129021
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||| |||||||| |||||||||||| | |||||| |||||||||| ||||||| |
|
|
| T |
38129074 |
ttatatgcaggggtcggggttcgaaccctggacactccacttattcaccttgaa |
38129021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 1572149 - 1572189
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
1572149 |
tgcaggggctggggttcgaaccccggactccccacttattc |
1572189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 3294122 - 3294162
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
3294122 |
tgcaggggccggggttcgaattccggacaacccatttattc |
3294162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 7171770 - 7171806
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7171770 |
tgcaggggccggggttcgaaccccagacaccccactt |
7171806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 9963416 - 9963500
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| |||| || ||||||||||||| ||| | |||| |||||||| |||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
9963416 |
tgagtatagctcagttggcagggacaatgcattgttatatgcaggggttggggttcgaacttcggaccccccacttattcacctt |
9963500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 13862116 - 13862203
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| || ||||||||| || |||| || ||| |||| | |||| |||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
13862116 |
attgtccccgtgagcatagttcagttgacatggatatgcattgttatatgcaggggtcggagttcgaac-ccggacaccccacttattc |
13862203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 15106943 - 15106903
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
15106943 |
tgcagaggtcggggttcgaaccccggacaccccacttattc |
15106903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 17077400 - 17077440
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
17077400 |
tgcaggggtcgggattcgaaccccggacaccccacttattc |
17077440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 29561687 - 29561727
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
29561687 |
tgcaggggccggggttcgaaccccagacatcccacttattc |
29561727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 1040 - 1126
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||| |||||||||| ||||||| || |||||| ||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
1040 |
tgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcaccttgaa |
1126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 76)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 34107275 - 34107361
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||||| |||||||| | |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
34107275 |
tgagcatagctcagttggcagggacatgtataattatatgcaggggttgaggttcgaactccagacaccccacttattcaccttgaa |
34107361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 29034976 - 29035055
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29034976 |
tgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattc |
29035055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 43870950 - 43871032
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||| | ||||| |||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
43870950 |
ccatgagcatagctcggttggcaaggacaatgcattattatatgcaggagccggggttcgaatcccggacaccccacttattc |
43871032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 580845 - 580794
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
580845 |
attatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
580794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 17154682 - 17154733
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
17154682 |
attatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
17154733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 1244570 - 1244656
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| || |||||||||||||| | | ||| |||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1244570 |
tgagcatagttcagttggcagggacatacattgctatatgcaggggtgggggttcgaaccccggacaccccacttattcaccttgaa |
1244656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 3037683 - 3037633
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3037683 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
3037633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 39334975 - 39334897
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || |||||||||||||||| | ||||| | ||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
39334975 |
tgagcataactcagttggcagggacatgcattattatatacaggggctggggttcgaactccagacatcccacttattc |
39334897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 221
Target Start/End: Original strand, 44187698 - 44187783
Alignment:
| Q |
137 |
tctccatgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||| || ||||||||||| | ||| | ||||| |||||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
44187698 |
tctccgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattc |
44187783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 11133076 - 11133160
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| ||||||| ||| | |||| |||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11133076 |
tgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11133160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 14307798 - 14307710
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| ||||||| | || ||||| |||||||||| | |||| |||||||| || ||||||||| ||| ||||||||||||||| |
|
|
| T |
14307798 |
attgtctccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttattc |
14307710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 18424208 - 18424168
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18424208 |
tgcaggggccggggttcgaactccggacatcccacttattc |
18424168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 8234854 - 8234803
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8234854 |
attatatgtaggggccggggttcgaaccccggacaccccacttattcacctt |
8234803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 18386874 - 18386823
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| || |||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18386874 |
attatatgtaggggctggggttcgaactccggacaccccacttattcacctt |
18386823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 221
Target Start/End: Complemental strand, 32527168 - 32527093
Alignment:
| Q |
147 |
catagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||||||||||| ||| | ||||| ||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
32527168 |
catagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttattc |
32527093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 229
Target Start/End: Original strand, 34830630 - 34830673
Alignment:
| Q |
186 |
gggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
34830630 |
gggccggggttcgaactccggacaccccatttattctccttgaa |
34830673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 9796930 - 9796976
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
9796930 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattc |
9796976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 11050791 - 11050749
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11050791 |
attatatgcaggggctggggttcgaactccggacaccccactt |
11050749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 33228967 - 33228925
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33228967 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
33228925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 36665463 - 36665509
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36665463 |
attatatgcaggggccggggttcgaacctcggacaccccacttattc |
36665509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 4529835 - 4529759
Alignment:
| Q |
165 |
gacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaattt |
242 |
Q |
| |
|
||||||| | ||||| |||||||| ||| |||||||||||| ||||||||||||||| | ||||| | |||||||||| |
|
|
| T |
4529835 |
gacatgcattattatatgcaggggtcggagttcgaactccgaacaccccacttattcactttgaa-aaaggtgaattt |
4529759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 18254626 - 18254667
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18254626 |
ttatatgcaggggccggggttcgaactccagacaccccactt |
18254667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 20942190 - 20942117
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||| || |||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
20942190 |
gttggcagggacatgcataattatatgtaggggatggagttcgaaccccagacacctcacttattcaccttgaa |
20942117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 227
Target Start/End: Original strand, 22355075 - 22355168
Alignment:
| Q |
134 |
ttgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| || ||||||||| || ||||||| |||||||| | |||| |||||||| | | |||||||||| |||||||||||||||| ||||| |
|
|
| T |
22355075 |
ttgtccccgtgagcatagctcagttggcaaggacatgcattgttatgtgcaggggttgagtttcgaactccagacaccccacttattcaccttg |
22355168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 190 - 227
Target Start/End: Complemental strand, 25406697 - 25406660
Alignment:
| Q |
190 |
cggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25406697 |
cggggttcgaactccggacaccccacttattcaccttg |
25406660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 229
Target Start/End: Complemental strand, 41305163 - 41305074
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||| || |||||||| | |||| | | ||| ||||||||| | ||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
41305163 |
ccatgagcatagctcagttggcagaggcatgtattagtatatgcaggggctgaggttcaaactccggataccccacttattcaccttgaa |
41305074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 1962865 - 1962905
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
1962865 |
tgcaggggtcgaggttcgaactccggacaccccacttattc |
1962905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 17543146 - 17543106
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
17543146 |
tgcaggggccggagttcgaacgccggacaccccacttattc |
17543106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 36413780 - 36413859
Alignment:
| Q |
162 |
agggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaatagaggtgaattt |
242 |
Q |
| |
|
|||||||||| | |||| |||||||||||| |||||||| | ||||||||||||||||| | ||||| | |||||||||| |
|
|
| T |
36413780 |
agggacatgcattgttatatgcaggggccggagttcgaaccctggacaccccacttattcactttgaa-aaaggtgaattt |
36413859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 226
Target Start/End: Complemental strand, 44487842 - 44487778
Alignment:
| Q |
162 |
agggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||||| | ||||| |||| ||||||| |||||||| ||||||| ||||||||||| |||| |
|
|
| T |
44487842 |
agggacatgcattattatatgcaagggccggagttcgaaccccggacatcccacttattcacctt |
44487778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 6952293 - 6952356
Alignment:
| Q |
163 |
gggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| ||||||| ||| ||||| ||||||||||| || ||||||||| |||||| |||| |
|
|
| T |
6952293 |
gggacatgcataattatatgcgggggctggggttcgaaccccagacaccccatttattcacctt |
6952356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 7086254 - 7086337
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| || ||||| |||| |||| | ||||| ||||||||||||| ||||||| ||| |||||||| |||||| |||| |
|
|
| T |
7086254 |
tgagcatagctcagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcacctt |
7086337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Original strand, 10262772 - 10262823
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| |||||||| |||||||||||| || |||||||||||||||| |||| |
|
|
| T |
10262772 |
attatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
10262823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 22297514 - 22297463
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||| ||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
22297514 |
attatatgcaggggcaggggttcgaaccccggacaccccatttattcacctt |
22297463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 24202189 - 24202224
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24202189 |
tgcaggggccggggttcgaaccccggacaccccact |
24202224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 30474257 - 30474206
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||| || |||||||||||||||| |||| |
|
|
| T |
30474257 |
attatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
30474206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 32256176 - 32256215
Alignment:
| Q |
182 |
gcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32256176 |
gcaggggtcggggttcgaactccggacatcccacttattc |
32256215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 34034351 - 34034429
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| | | | ||||| |||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
34034351 |
tgagcatagctcagttggcagggacaatacattattatatgcagga-ccggggttcgaaccccggacaccccacttattc |
34034429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 1844853 - 1844895
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1844853 |
attatatgcaggggccggggttcgaacctcggacaccccactt |
1844895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 2304290 - 2304368
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| ||| || ||||||||||||| || | ||||| || ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2304290 |
tgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatt |
2304368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 5612990 - 5613032
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
5612990 |
attatatgcaagggccggggttcgaaccccggacaccccactt |
5613032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 9547189 - 9547143
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
9547189 |
attatatgcaggggccggggttcgaatcccgaacaccccacttattc |
9547143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 10602019 - 10602085
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactc-cggacaccccacttattc |
221 |
Q |
| |
|
|||||||| ||||||| | |||| |||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
10602019 |
gttggcagagacatgcattgttatatgcaggggacggggttcgaacccacggacaccccacttattc |
10602085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 17777197 - 17777155
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
17777197 |
attatatgcaggggtcggggttcgaaccccggacaccccactt |
17777155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 20122537 - 20122491
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
20122537 |
attatatgtaggggccggggttcgaaccccggacacgccacttattc |
20122491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 33116261 - 33116223
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
33116261 |
caggggccggggttcgaaccccggacaccctacttattc |
33116223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 35352500 - 35352446
Alignment:
| Q |
147 |
catagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaac |
201 |
Q |
| |
|
||||| || |||||||||||||||| ||||||| ||| ||||| ||||||||||| |
|
|
| T |
35352500 |
catagctcagttggcagggacatgcataattatatgcgggggctggggttcgaac |
35352446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 36101695 - 36101737
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36101695 |
attatatgcaggggctggggttcgaaccccggacaccccactt |
36101737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 36520842 - 36520796
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| || ||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
36520842 |
attatatgtaggggtcggggttcgaaccccggacaccccacttattc |
36520796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 230
Target Start/End: Original strand, 37912471 - 37912517
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattcgccttgaat |
230 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
37912471 |
aggggtcggggttcaaaccccggacaccccacttattcaccttgaat |
37912517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 40535483 - 40535441
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40535483 |
attatatgcaggggccggggttcgaaccccggacactccactt |
40535441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 41699135 - 41699181
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
41699135 |
attatatgcaggggtcggggttcgaaccccgaacaccccacttattc |
41699181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 43200873 - 43200919
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
43200873 |
attatatgcaggggccggagttcgaaccccgaacaccccacttattc |
43200919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 1964371 - 1964431
Alignment:
| Q |
157 |
ttggcagggacat-gcgtaattatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||| || ||||| | ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1964371 |
ttggcagggacattgcataatt-tatgcaggggccggggttcaaaccccggacaccccactt |
1964431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Original strand, 4659453 - 4659486
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
4659453 |
aggggctggggttcgaactccggacaccccactt |
4659486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 9802925 - 9802970
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||| |||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
9802925 |
attatatgcaagggtcggggttcgaaccccggacaccccacttatt |
9802970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 12206512 - 12206585
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
||||||||| |||| | | ||||| | |||||| |||||||||||| ||| ||||||| ||||||| ||||||| |
|
|
| T |
12206512 |
gttggcaggaacatacattattatattcaggggtcggggttcgaaccccgaacaccccgcttattcaccttgaa |
12206585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 17896823 - 17896880
Alignment:
| Q |
140 |
ccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttc |
197 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||||||| | |||||| ||||||| |
|
|
| T |
17896823 |
ccatgagcatagctcagttggcagggacatgcataattatatacaggggttggggttc |
17896880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 23405238 - 23405283
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
23405238 |
tgcaggggtcggggttcgaaccctggacaccccacttattcacctt |
23405283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 23984256 - 23984215
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
23984256 |
ttatatgcaggggccagggttcgaaccccggacaccccactt |
23984215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 32221004 - 32221045
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32221004 |
ttatatgcaggggccggggttcgaacctcggacaccccactt |
32221045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 33001622 - 33001569
Alignment:
| Q |
168 |
atgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||| ||||| |||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
33001622 |
atgcgttattatatgcaagggccggggtttgaatcccggacaccccacttattc |
33001569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 34018126 - 34018081
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34018126 |
tgcaggggctggggttcgaacctcggacaccccacttattcacctt |
34018081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 37884848 - 37884913
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||| |||| | ||||| ||| ||| ||||||||||||||||| ||||| | ||||||| |
|
|
| T |
37884848 |
gttggcagggatatgcattattatatgcggggaccggggttcgaactccgaacaccgcgcttattc |
37884913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 38807895 - 38807968
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| | | ||||||| || |||||| ||||||||| ||||||| |
|
|
| T |
38807895 |
gttggcagggacatgcataattatatgcagggaatgagattcgaaccccagacaccgcacttattcaccttgaa |
38807968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 3596292 - 3596328
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3596292 |
tgcaggggtcggggttcgaaccccggacaccccactt |
3596328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 229
Target Start/End: Complemental strand, 5029204 - 5029108
Alignment:
| Q |
133 |
attgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||| ||||||||| || ||||| ||| | |||| | ||||| ||||| |||||| ||||||| || ||||||||||||||| ||||||| |
|
|
| T |
5029204 |
attgtctctgtgagcatagctcagttggtaggtatatgcattattatatgcagaggccggagttcgaatctcgaacaccccacttattcaccttgaa |
5029108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 5901887 - 5901847
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
5901887 |
tgcaggggccggggtacaaaccccggacaccccacttattc |
5901847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 5947903 - 5947943
Alignment:
| Q |
176 |
ttatttgcaggggccggggttcgaactccggacaccccact |
216 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
5947903 |
ttatatgcaggggtcggggttcgaaccccggacaccccact |
5947943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 217
Target Start/End: Original strand, 20919656 - 20919688
Alignment:
| Q |
185 |
ggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
20919656 |
ggggccggggttcgaaccccggacaccccactt |
20919688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 226
Target Start/End: Complemental strand, 21875042 - 21874982
Alignment:
| Q |
166 |
acatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
|||||| ||||||| ||||||||| | ||||||| | ||||||||||||||| ||| |||| |
|
|
| T |
21875042 |
acatgcataattatatgcaggggcagaggttcgatccccggacaccccactttttcacctt |
21874982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 32190030 - 32189994
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
32190030 |
tgcaggggccggggttcgaaccccggacacctcactt |
32189994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 37063556 - 37063596
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccac |
215 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37063556 |
attatatgcaggggccagggttcgaactccggacactccac |
37063596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 37123209 - 37123265
Alignment:
| Q |
165 |
gacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||| | ||||| |||||||| || | |||||||||||||||||| |||||||| |
|
|
| T |
37123209 |
gacatgcattattatatgcaggggtcgagattcgaactccggacaccctacttattc |
37123265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 42998880 - 42998844
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42998880 |
tgcaggggccggagttcgaactccggacacccgactt |
42998844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 44558044 - 44558080
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
44558044 |
tgcaggggctggggttcgaaccccggacaccccactt |
44558080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 25026 - 25105
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
25026 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattc |
25105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 451428 - 451391
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
451428 |
aggggccggggttcgaactccggacaccccacttattc |
451391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 226
Target Start/End: Original strand, 440413 - 440483
Alignment:
| Q |
156 |
gttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgcctt |
226 |
Q |
| |
|
||||||||| |||||| | ||||| || |||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
440413 |
gttggcaggaacatgcattattatatgtaggggccggggttcgactcccgaacaccccacttattcacctt |
440483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 6695 - 6643
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattcgccttg |
227 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
6695 |
attatatgcaggggccggggttcgaaccccggacaccccaattattcaccttg |
6643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 419751 - 419791
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
419751 |
tgcaggggccggggttcgaaccccggacaccccacttattc |
419791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 4900 - 4822
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || ||||||||||||| ||| | ||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4900 |
tgagcatagctcagttggcagggacaatgcattattatatgcaggggc-ggggttcgaatcccggacaccccacttattc |
4822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 7076 - 7155
Alignment:
| Q |
143 |
tgagcatagatcggttggcagggaca-tgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||||||| || |||| ||||||| ||| | ||||| ||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
7076 |
tgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttattc |
7155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 10860 - 10818
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10860 |
attatatgcaggggccggggttcgaaccccggacaccccactt |
10818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 2990 - 2954
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2990 |
tgcaggggccggggttcgaaccccggacaccccactt |
2954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 28849 - 28813
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28849 |
tgcaggggccggggttcgaaccccggacaccccactt |
28813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 229
Target Start/End: Original strand, 67161 - 67248
Alignment:
| Q |
142 |
atgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttattcgccttgaa |
229 |
Q |
| |
|
|||||||||| || ||||| ||||| |||| | |||| || |||||| ||||||||||| | |||||||||||||| || ||||||| |
|
|
| T |
67161 |
atgagcatagctcagttgggagggatatgcattgttatatgtaggggctggggttcgaaccctggacaccccacttaatcaccttgaa |
67248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 4356 - 4402
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
4356 |
attatatgcaggggtcggggttcgaaccccggacactccacttattc |
4402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 217
Target Start/End: Complemental strand, 18505 - 18471
Alignment:
| Q |
183 |
caggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18505 |
caggggccggggttcgaaccccggacaccccactt |
18471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 66622 - 66580
Alignment:
| Q |
175 |
attatttgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
66622 |
attatatgcaggggccggggttcgaaccccggacacctcactt |
66580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 236385 - 236347
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccacttat |
219 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
236385 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
236347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 4513 - 4598
Alignment:
| Q |
135 |
tgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||| | |||| |||||||| | | || ||||| |||| |||||||||||| |
|
|
| T |
4513 |
tgtctccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcagaatttgaacttcggataccccacttatt |
4598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 4533 - 4618
Alignment:
| Q |
135 |
tgtctccatgagcatagatcggttggcagggacatgcgtaattatttgcaggggccggggttcgaactccggacaccccacttatt |
220 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||| | |||| |||||||| | | || ||||| |||| |||||||||||| |
|
|
| T |
4533 |
tgtctccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcagaatttgaacttcggataccccacttatt |
4618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 49862 - 49899
Alignment:
| Q |
184 |
aggggccggggttcgaactccggacaccccacttattc |
221 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
49862 |
aggggccggggttcgaaccccgtacaccccacttattc |
49899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 17289 - 17253
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
17289 |
tgcaggggccggggttcgaaccccggacactccactt |
17253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 24422 - 24458
Alignment:
| Q |
181 |
tgcaggggccggggttcgaactccggacaccccactt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24422 |
tgcaggggccggggttcgaaccccggacactccactt |
24458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University