View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_high_99 (Length: 236)
Name: NF5400_high_99
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_high_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 31810611 - 31810478
Alignment:
| Q |
1 |
ggataaaaccaaaacacttgatgtaagattgcaaacaaagactaagaagttggacaacaacaaaactacacaaattaagggctgtgaagggtgaagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810611 |
ggataaaaccaaaacacttgatgtaagattgcaaacaaagactaagaagttggacaacaacaaaactacacaaattaagggctgtgaagggtgaagaaag |
31810512 |
T |
 |
| Q |
101 |
agcataacacaagggtatgaaaggtttgacaata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31810511 |
agcataacacaagggtatgaaaggtttgacaata |
31810478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 135 - 218
Target Start/End: Complemental strand, 31810331 - 31810248
Alignment:
| Q |
135 |
gtatgtcccaacccacttgaacacctgtaaagaccgacacagaaatttatgctctcacgtccaagcattttgtagtgcgtgtag |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810331 |
gtatgtcccaacccacttgaacacccgtaaagaccgacacagaaatttatgctctcacgtccaagcattttgtagtgcgtgtag |
31810248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University