View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_108 (Length: 236)
Name: NF5400_low_108
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 75 - 219
Target Start/End: Complemental strand, 39281896 - 39281749
Alignment:
| Q |
75 |
tgaactcaattgattctcagcagcacaaaatctgctgaaacaatacatttgcttctaccatcaacgtacttgcagtctgacaaactctgacatt---tga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39281896 |
tgaactcaattgattctcagcagcacaaaatctgctgaaacaatacatttgcttctgccatcaacgtacttgcagtctgacaaactctgacatttactga |
39281797 |
T |
 |
| Q |
172 |
gaaggagcacatgattaatttattgagatttcatctgacacaaaaatt |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39281796 |
gaaggagcagatgattaatttattgagatttcatctgacacaaaaatt |
39281749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University