View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_117 (Length: 231)
Name: NF5400_low_117
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_117 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 52035225 - 52035460
Alignment:
| Q |
6 |
attaataagcttctcgaagggtgtcccgttgtagaggatttgcaaatcactgatttactactcgga----------gagtttaaaatcttatccaatttc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52035225 |
attaataagcttctcgaagggtgtcccgttgtagaggatttgcaaatcactgatttactactcggaaagtaacggagagtttaaaatcttatccaatttc |
52035324 |
T |
|
| Q |
96 |
gtcaaagataatgttctgaatttgcagagaggaaggggattgttggacagagaccgagtaacaatgctattttgttaaagttacaataagttgaaattga |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035325 |
gtcaaagataatgttttgaatttgcagagaggaaggggattgttggacagagaccgagtaacaatgctattttgttaaagttacaataagttgaaattga |
52035424 |
T |
|
| Q |
196 |
tttctaatgtttgtctagatgtccaaccaacaatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035425 |
tttctaatgtttgtctagatgtccaaccaacaatgt |
52035460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University