View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5400_low_132 (Length: 207)

Name: NF5400_low_132
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5400_low_132
NF5400_low_132
[»] chr8 (1 HSPs)
chr8 (1-188)||(5746719-5746906)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 5746719 - 5746906
Alignment:
1 ccatcaatgttcaacccatactactaaccatatttccgtcggtattgcaactttttcaagttaatgacataaacattaagaaaagaagaagnnnnnnnnc 100  Q
    |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||        |    
5746719 ccatcaatgttcaacccatactactaaccatatttctgtcggtaatgcaactttttcaagttaatgacataaacattaagaaaagaagaagaaaaaaaac 5746818  T
101 ctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5746819 ctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcat 5746906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University