View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_132 (Length: 207)
Name: NF5400_low_132
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_132 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 5746719 - 5746906
Alignment:
| Q |
1 |
ccatcaatgttcaacccatactactaaccatatttccgtcggtattgcaactttttcaagttaatgacataaacattaagaaaagaagaagnnnnnnnnc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5746719 |
ccatcaatgttcaacccatactactaaccatatttctgtcggtaatgcaactttttcaagttaatgacataaacattaagaaaagaagaagaaaaaaaac |
5746818 |
T |
 |
| Q |
101 |
ctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5746819 |
ctgtggtgaagtatttctccggagtcgaaccctaattcatttctttcatcacaaggtatatcaagaattggcttatgatcatactcat |
5746906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University