View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_19 (Length: 511)
Name: NF5400_low_19
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 26642500 - 26642734
Alignment:
| Q |
11 |
taattctggatcataaaaggattcttacattaggcgggataggttcctgtgatgtgttctgatacccaagtgatggaggtatgacgactctacgaatacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642500 |
taattctggatcataaaaggattcttacattaggtgggataggttcctgtgatgtgttctgatacccaagtgatggaggtatgacgactctacgaatacc |
26642599 |
T |
 |
| Q |
111 |
accgactttcattgatctcactgcgacatcaattccagcaattacctgaacacaaacatttcattctcatataattaacttctttcttagtatgac--at |
208 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||| | |||||||| || |
|
|
| T |
26642600 |
accgactttcattgatcgcactgccacatcaattccagcaattacctgaacac--acatttctttctcatatgattaacttctttataagtatgacatat |
26642697 |
T |
 |
| Q |
209 |
gataaaggcatgggaattaatttaattacaacttttc |
245 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26642698 |
gataaaggcatagaaattaatttaattacaacttttc |
26642734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University