View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_37 (Length: 395)
Name: NF5400_low_37
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 380
Target Start/End: Original strand, 34382638 - 34383003
Alignment:
| Q |
17 |
cactgttcccgttattgagtatcattgtccttatgacccaggcttcatggcgaggcattcttctctttttcgtggttcttgctctatctgtctggtatca |
116 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| |||||||| |||||| || |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34382638 |
cactgatccagttattgagtatcattgtccttatgtcccaggctgcatggcaagtcattcttctctttttcgtggttcttgctctctctgtctggtatca |
34382737 |
T |
|
| Q |
117 |
ggtaagaactagcattctttgctaatgtacacaaacactacatattaa--tannnnnnnnnattttgttaagattttacgatgcatgaactgaaaatttc |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382738 |
ggtaagaactatcattctttgctaatgtacacaaacactacatattaaatttttttttttaattttgttaagattttacgatgcatgaactgaaaatttc |
34382837 |
T |
|
| Q |
215 |
atgttttagttcatgttatgatgaatcctaattttgtcatacatgtttgcattgcatgttctcactcttgcattgattatcctagtattcaaatgatgag |
314 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382838 |
atggttcagttcatgttatgatgaatcctaattttgtcatacatgttcgcattgcatgttctcactcttgcattgattatcctagtattcaaatgatgag |
34382937 |
T |
|
| Q |
315 |
ggaaattgtgtatttatttgcaggcctattacatcactacggctagggaattggccaggatggtgg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382938 |
ggaaattgtgtatttatttgcaggcctattacatcactacggctagggaattggccaggatggtgg |
34383003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University