View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_68 (Length: 283)
Name: NF5400_low_68
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-153
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 38508701 - 38508981
Alignment:
| Q |
1 |
attttgttgcctttgaggaatatcttggtaagatgacatagttgattcatcacttccttcaatcactccttgctttctcatatattccaatttgtcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38508701 |
attttgttgcctttgaggaatatcttggtaagatgacatagttgattcatcacttccttcaatcactccttgctttctcatatattccaatttgtcttgg |
38508800 |
T |
|
| Q |
101 |
aagagataaatcaatccaatgaaaaagacttccaccgtaaaaagtatagtccaaaacattgtgctttttaaggttctcttgtgatatgcttttaatcctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38508801 |
aagagataaatcaatccaatgaaaaagacttccaccgtaaaaagtatagtccaaaacattgtgctttttaaggttctcttgtgatatgcttttaatcctg |
38508900 |
T |
|
| Q |
201 |
tgtaaatgttgatgatccccacaagggaaactattgtccctagtatccagtgtacaaagtaccaataactcctttgcttct |
281 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38508901 |
tgaaaatgttgatgatccccacaagggaaactattgtccctagtatccagtgtacaaagtaccaataactcctttgtttct |
38508981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University