View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_71 (Length: 279)
Name: NF5400_low_71
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_71 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 6 - 279
Target Start/End: Complemental strand, 39692964 - 39692691
Alignment:
| Q |
6 |
agaagcaaaggacaatattgaatgggaccaaacagttgcatgcgtggcacttgtaacacagattcgggaaaattcgatgagttcttggaatcttgagtac |
105 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39692964 |
agaagaaaaggacaattttgaatgggaccaaacagttgcatgcgtggcacttgtaacacagattcgggaaaattcgatgagttattggaatcttgagtac |
39692865 |
T |
|
| Q |
106 |
tagcgcgtatgtgcacgctcaaatgttactgg-ttactag-ttattcagtgtggacaattgtcacgtacatgccacgtggtatgattttgataataaagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
39692864 |
tagcgcgtatgtgcacgctcaaatgttactggtttactagtttattcagtgtggacaattgtcacgtacgtgccacgttgtatgattttgatgataaagt |
39692765 |
T |
|
| Q |
204 |
tgtgaagagattgactcggtctaggtgaacagaacaaccagatgaaatgccaggtaggaccttcaccatgggccac |
279 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39692764 |
tgtga--agattgactcggtctaggtgaacagaacaaccagatgaaatgccaagtaggaccttcaccatgggccac |
39692691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University