View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_78 (Length: 255)
Name: NF5400_low_78
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 166 - 248
Target Start/End: Original strand, 16591628 - 16591710
Alignment:
| Q |
166 |
tgcatctcaattgcatttctacataatgttcaactaaaacatggatacaacatggacttctgctctcaaaataatgttcttga |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16591628 |
tgcacctcaattgcatttctacataatgttcaactaaaacatggatacaacatggacttctgctctcaaaataatgctcttga |
16591710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 67 - 144
Target Start/End: Original strand, 16591474 - 16591551
Alignment:
| Q |
67 |
gacatttgagccctttaattttagtttttccnnnnnnnnnnnngggtttttgtgtccaagtaaaaaggtgttggttgc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
16591474 |
gacatttgagccctttaattttagtttttccaaaaaaaaacaagggtttttgtgtccaagtgaaaaggtgttggttgc |
16591551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 115 - 144
Target Start/End: Complemental strand, 29558223 - 29558194
Alignment:
| Q |
115 |
tttgtgtccaagtaaaaaggtgttggttgc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29558223 |
tttgtgtccaagtaaaaaggtgttggttgc |
29558194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 97
Target Start/End: Original strand, 30971953 - 30971983
Alignment:
| Q |
67 |
gacatttgagccctttaattttagtttttcc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30971953 |
gacatttgagccctttaattttagtttttcc |
30971983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 97
Target Start/End: Original strand, 31135844 - 31135874
Alignment:
| Q |
67 |
gacatttgagccctttaattttagtttttcc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31135844 |
gacatttgagccctttaattttagtttttcc |
31135874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University