View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_81 (Length: 253)
Name: NF5400_low_81
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 244
Target Start/End: Original strand, 11364875 - 11365111
Alignment:
| Q |
8 |
cgaatctaaaggtttctctgcctggattaatcagatgcttgtcacatcttgttaagaatgatgtagaaaatgatttgcttgacaaggtatatcttgtact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11364875 |
cgaatctaaaggtttctctgcctggattaatcagatgcttgtcacatcttgttaagaatgatgtagaaaatgatttgcttgacaaggtatatcttgtact |
11364974 |
T |
 |
| Q |
108 |
ctattaacatttaattttggtgagtttttgttacctgaaacaacagtacattggtcattctttttaaactgctaaatatctttgcatcacataaacatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11364975 |
ctattaacatttaattttggtgagtttttgttacctgaaacaacagtagattggtcattctttttaaactgctgcatatctttgcatcacataaacatat |
11365074 |
T |
 |
| Q |
208 |
tttacatcttagcattgtcatttcatttcccctttgc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11365075 |
tttacatcttagcattgtcatttcatttcccctttgc |
11365111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University