View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5400_low_90 (Length: 250)

Name: NF5400_low_90
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5400_low_90
NF5400_low_90
[»] chr5 (1 HSPs)
chr5 (31-216)||(10268338-10268523)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 31 - 216
Target Start/End: Complemental strand, 10268523 - 10268338
Alignment:
31 gagtgactaaaaattcatctttaaaatgaataaattgagtgtcaggagttcaaacaccgacctccacagatattatgcaatgtctctcttgatctggtgg 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||    
10268523 gagtgactaaaaattcatctttaaaatgaataaattgagtgtcaggagttcaaacaccgacctccacaaatattatgcaatgtctctcttggtctagtgg 10268424  T
131 tattaactcgagatctgtaaacgtgctcattcccgagatctcaagttcgattcagattcaagttggatgaggtcctttagtttctt 216  Q
    |||||||| |||||||||  |||||||| ||| |||||||||| |||||||||||||||||||||||||||||  |||| ||||||    
10268423 tattaacttgagatctgtgcacgtgctccttctcgagatctcaggttcgattcagattcaagttggatgaggtaatttaatttctt 10268338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University