View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_92 (Length: 246)
Name: NF5400_low_92
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 16591726 - 16591957
Alignment:
| Q |
1 |
catcaggtatgaaacaaataaattgagtaaattttttatgcttcatatgatttttaacttcaaactaacttacctttaaatacctcaccttacatatacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16591726 |
catcaggtatgaaacaaataaattgagtaaattttttatgcttcatatgatttttaacttcaaactaacttacctttaaatacctcaccttacatataca |
16591825 |
T |
 |
| Q |
101 |
aatgatattttgtccacatgaattgttgtttgtgcatttagatatgtgcaaggaatcagaagaaagaggaccagaagtggaacaatgtgacgatgaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16591826 |
aatgatattttgtccacatgaattgttgtttgtgtatttagatatgtgcaaggaatcagaagaaagaggaccagaagtggaacaatgtgacgatgaacaa |
16591925 |
T |
 |
| Q |
201 |
tgccaaaaaatatgttattgtcttccaaaatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16591926 |
tgccaaaaaatatgttattgtcttccaaaatg |
16591957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University