View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5400_low_95 (Length: 244)
Name: NF5400_low_95
Description: NF5400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5400_low_95 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 30431934 - 30431721
Alignment:
| Q |
19 |
tttctagtcatggccatagtgattaatgcctactctatgttgcggatactatattttatttcatattcagatacaacatttattgctttgttatatatga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30431934 |
tttctagtcatggccatagtgattaatgcctactctatgttgcggatactatattttatttcatattcagatacaacatttattgttttgttatatatga |
30431835 |
T |
 |
| Q |
119 |
ccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggtaccatttggagtcagtgttgctggaaggttagtcttgcatgctgag |
218 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30431834 |
ccaaatttacattttcatcctcagtattaatgtatctggtatgttttggatgataccatttggggtcagtgttgctggaaggttagtcttgcatgctgag |
30431735 |
T |
 |
| Q |
219 |
ctctactaaaatat |
232 |
Q |
| |
|
||||| ||| |||| |
|
|
| T |
30431734 |
ctctattaatatat |
30431721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 85 - 215
Target Start/End: Complemental strand, 30415229 - 30415099
Alignment:
| Q |
85 |
tcagatacaacatttattgctttgttatatatgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggtaccatttggagt |
184 |
Q |
| |
|
||||||||||| |||||||||| |||| | || | |||||||| |||||||| ||||||||||||||| |||||| ||||||||||||| |||||| | |
|
|
| T |
30415229 |
tcagatacaaccattattgctttattatctgtggctaaatttactttttcatctacagtgttaatatatccggtatgctttggatggtaccgtttggaat |
30415130 |
T |
 |
| Q |
185 |
cagtgttgctggaaggttagtcttgcatgct |
215 |
Q |
| |
|
|||||| ||| ||||||||| |||||||| |
|
|
| T |
30415129 |
tagtgtttctgcaaggttagtagtgcatgct |
30415099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 82 - 215
Target Start/End: Complemental strand, 30380523 - 30380388
Alignment:
| Q |
82 |
tattcagatacaaca-tttattgctttgttatata--tgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggtaccatt |
178 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| ||||| || | || ||||| ||| ||| ||||||||| |||| || |||||||| ||||| |
|
|
| T |
30380523 |
tattcagatacatcaatttattgctttgttatatacctgacccaagt-actttttcttccatagtattaatatattgggtacattctggatggtgccatt |
30380425 |
T |
 |
| Q |
179 |
tggagtcagtgttgctggaaggttagtcttgcatgct |
215 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
30380424 |
cggagttagtgttgcaggaaggttagtctttcatgct |
30380388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University