View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5402-Insertion-1 (Length: 89)
Name: NF5402-Insertion-1
Description: NF5402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5402-Insertion-1 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 44; Significance: 1e-16; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 9 - 89
Target Start/End: Complemental strand, 15169319 - 15169241
Alignment:
| Q |
9 |
taagcaggtgatcctctcacttcctaaagaaaatgggtggggattgtccc-aaatttatatttgtttcaatgtttttggtgt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
15169319 |
taagcaggtgatcctctcacttcctaaagaaaatgcatggatattgtcccaaaatttatat---tttcaatgtttttggtgt |
15169241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 15076372 - 15076434
Alignment:
| Q |
25 |
tcacttcctaaagaaaatgggtggggattgtccc-aaatttatatttgtttcaatgtttttggtgt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
15076372 |
tcacttcctaaagaaaatgggtggggattgtcccaaaatgtatat---tttcaatgtttttggtgt |
15076434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 15172139 - 15172062
Alignment:
| Q |
10 |
aagcaggtgatcctctcacttcctaaagaaaatgggtggggattgtccc-aaatttatatttgtttcaatgtttttggtgt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
15172139 |
aagcaggtgatcctctcacttcctaaagaaaatgcatggatattgtcccaaaatgtatat---tttcaatgtttttggtgt |
15172062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University