View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5402_high_7 (Length: 347)
Name: NF5402_high_7
Description: NF5402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5402_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 266 - 328
Target Start/End: Original strand, 42486735 - 42486797
Alignment:
| Q |
266 |
tgagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
42486735 |
tgagttcagatcctctccatttggagggtaaatggccatctccctttactttcatatccaact |
42486797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 267 - 328
Target Start/End: Complemental strand, 42489238 - 42489177
Alignment:
| Q |
267 |
gagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
42489238 |
gagttcagatcctcttcatttggagagtaaatggtcatcttcctttactttcatatccaact |
42489177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 266 - 328
Target Start/End: Complemental strand, 38617330 - 38617268
Alignment:
| Q |
266 |
tgagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
38617330 |
tgagttcagatcctctccatttggagagtaaatggccatctccctttactttcatatccaact |
38617268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 328
Target Start/End: Original strand, 38614784 - 38614845
Alignment:
| Q |
267 |
gagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
38614784 |
gagttcagatcctcttcatttggagggtaaatggccatctccctttactttcatatccaact |
38614845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 328
Target Start/End: Original strand, 40805934 - 40805995
Alignment:
| Q |
267 |
gagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
40805934 |
gagttcagatcctctccatttggagagtaaatggccatctccctttactttcatatccaact |
40805995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 328
Target Start/End: Complemental strand, 40808486 - 40808425
Alignment:
| Q |
267 |
gagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
40808486 |
gagttcagatcctctccatttggagggtaaatgaccatctccctttactttcatatccaact |
40808425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 267 - 328
Target Start/End: Complemental strand, 41663343 - 41663282
Alignment:
| Q |
267 |
gagttcagatcctctccatttggagggtaaatggccatcttcccttactttcatatccaact |
328 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
41663343 |
gagttcagatcctctccatttggagagtaaatggccatctccctttactttcatatccaact |
41663282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University