View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5403_low_3 (Length: 392)

Name: NF5403_low_3
Description: NF5403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5403_low_3
NF5403_low_3
[»] chr2 (1 HSPs)
chr2 (22-119)||(9375590-9375688)
[»] chr8 (2 HSPs)
chr8 (22-120)||(13017464-13017561)
chr8 (125-174)||(13017602-13017651)
[»] chr1 (2 HSPs)
chr1 (22-120)||(46177841-46177939)
chr1 (125-174)||(46177980-46178029)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 22 - 119
Target Start/End: Original strand, 9375590 - 9375688
Alignment:
Q  22 tccctcaccttttatgttctagttttgttgttattggaagattttgtagattgatttcttgtttccgttttcaatttcaata-ctccatcgatatcaat 119  Q
    ||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| | |||||||||    
T  9375590 tccctcaccttttctgttttacttttgttgttattggaagattttgtagattgatttcttgtttcagttttcaatttcaatatctcccttgatatcaat 9375688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 22 - 120
Target Start/End: Original strand, 13017464 - 13017561
Alignment:
Q  22 tccctcaccttttatgttctagttttgttgttattggaagattttgtagattgatttcttgtttccgttttcaatttcaata-ctccatcgatatcaatc 120  Q
    ||||||||||||| | ||||| |||||||||||||||||||||||||||| | | |||||||||| |||||||||||||||| |||| | ||||||||||    
T  13017464 tccctcaccttttct-ttctacttttgttgttattggaagattttgtaga-tcaattcttgtttcagttttcaatttcaatatctccgttgatatcaatc 13017561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 13017602 - 13017651
Alignment:
Q  125 tagttaatttcatcagatggagatggacgaacggggccggcgagaaggag 174  Q
    ||||||||||||||||||||||| |  || |||| |||||||||||||||    
T  13017602 tagttaatttcatcagatggagacgatcggacggcgccggcgagaaggag 13017651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 120
Target Start/End: Original strand, 46177841 - 46177939
Alignment:
Q  22 tccctcaccttttatgttctagttttgttgttattggaagattttgtagattgatttcttgtttccgttttcaatttcaata-ctccatcgatatcaatc 120  Q
    ||||||||||||| | ||||| |||||||||||||||||||||||||||| | | || ||||||| ||||| |||||||||| |||| | ||||||||||    
T  46177841 tccctcaccttttcttttctacttttgttgttattggaagattttgtaga-tcaattgttgtttcagtttttaatttcaatatctccgttgatatcaatc 46177939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 46177980 - 46178029
Alignment:
Q  125 tagttaatttcatcagatggagatggacgaacggggccggcgagaaggag 174  Q
    ||||||||||||||||||||||| |  || |||| |||||||||||||||    
T  46177980 tagttaatttcatcagatggagacgatcggacggcgccggcgagaaggag 46178029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University