View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5403_low_5 (Length: 373)
Name: NF5403_low_5
Description: NF5403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5403_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 14 - 365
Target Start/End: Original strand, 30131268 - 30131623
Alignment:
| Q |
14 |
ataataatatgtaatctctccatctgaacttcttccccttct---agaaattctgttcttttaagtacccttcgttttaccacaaattatcatt------ |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30131268 |
ataataatatgtaatctatccatctgaacttcttccccttcttctagaaattctgttcttttaagtacccttcgttttaccacaaat-atcatttctctt |
30131366 |
T |
 |
| Q |
105 |
gtaatttatacaattgaatcttcccttatttgagaaccacattgattggatttcatttggtacatataagaacccttgcacattattatttctctgactt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30131367 |
gtaatttatacaattgaatcttcccttatttgagaaccacattgattggatttcatttggtacatataagaacccttgcacattattatttctctgactt |
30131466 |
T |
 |
| Q |
205 |
ccaatataaagaaccaaattctcccatcattttcctattagaatgttgtctttctttttcaaggctaaggaacaatttctctcttccatgtcccaacaat |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30131467 |
ccaatataaagaaccaaatcctcccatcattttcctattagaatgttg----tctttttcaaggctaaggaacaatttctctcttccatgtcccaacaat |
30131562 |
T |
 |
| Q |
305 |
ttcattcttcgtggttttatgttacactctcagcctaattcccatttacacaatgatgatg |
365 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30131563 |
ttcattctttgtagttttatgctacactctcagcctaattcccatttacacaatgatgatg |
30131623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University