View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404-Insertion-3 (Length: 958)
Name: NF5404-Insertion-3
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404-Insertion-3 |
 |  |
|
| [»] scaffold0491 (2 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |  |
|
| [»] scaffold1519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 510; Significance: 0; HSPs: 29)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 510; E-Value: 0
Query Start/End: Original strand, 8 - 550
Target Start/End: Complemental strand, 35768662 - 35768122
Alignment:
| Q |
8 |
cactctacttcctggtcccaaacattcataatcactgtcactgattagatcatctaactgctctgagttagccacatcatccaaaacaataagaactttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35768662 |
cactctacttcctggtcccaaacattcataatcactgtcactgattagatcatctaactgctctgagttagccacattatccaaaacaataagaactttt |
35768563 |
T |
 |
| Q |
108 |
ttacgtctaagcctattgttaacatgacggtattcaactttgggtacatcaacatggagattctcttcctctaacagctctgaaaaaagcttgttgcgca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35768562 |
ttacgtctaagcctattgttaacatgacggtattcaactttgggtacatcaacatggagattctcttcctctaacagctctgaaaaaagcttgttgcgca |
35768463 |
T |
 |
| Q |
208 |
agaaatctatactattcttttctgtttgttcccttacattggccaaaaagcaatgaccttcaaattgagaaaatagtttggcatgtaaagaaattgctag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35768462 |
agaaatctatactattcttttctgtttgttcccttacattggccaaaaagcaatgaccttcaaattgagaaaatagtttggcatgtaaagcaattgctag |
35768363 |
T |
 |
| Q |
308 |
ggtactggtcttccctatgccacccatgccccatatcccaatccttttaacttcttttgatcccatttctaataatgatttaacaccttcataattttcc |
407 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35768362 |
gg---tggtcttccctatgccacccatgccccatatcccaatccttttaacttcttttgatcccatttctaataatgatttaacaccttcataattttcc |
35768266 |
T |
 |
| Q |
408 |
tcaatcccaaccactcccttcaactcaattggttgaacaagattcag-cgttgcaaaatgtctttaacaatgtctttgatgaattgagattcagacctga |
506 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35768265 |
tcaatcccaaccactcccttcaactcaattggttgaacaaaattcagtcgttgcaaaatgtctttaacaatgtctttgatgaattgagattcagacctga |
35768166 |
T |
 |
| Q |
507 |
catggaaatggtcacaagtgtaacgaaatgaatatcaatttaat |
550 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35768165 |
catggaaatggtcacaagtgtaacgaaatgaatatcaatttaat |
35768122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 736 - 772
Target Start/End: Complemental strand, 35767981 - 35767945
Alignment:
| Q |
736 |
ttgaccggagtttgaacccggaccttgcatatattat |
772 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35767981 |
ttgaccggagtttgaacccggaccttgcatatattat |
35767945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 881 - 939
Target Start/End: Complemental strand, 33386231 - 33386169
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
33386231 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
33386169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 737 - 781
Target Start/End: Original strand, 16792968 - 16793013
Alignment:
| Q |
737 |
tgaccggagtttgaaccc-ggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16792968 |
tgaccggggtttgaaccctggaccttgcatatattatgcattgtct |
16793013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 800779 - 800716
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
800779 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttccctgttcttc |
800716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 23198436 - 23198499
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatg--caattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
23198436 |
cagctcacggcatcacaaaatcgtgtcacgatgtcaaattcgtgtcacgatttctctgttcttc |
23198499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 23200635 - 23200698
Alignment:
| Q |
881 |
cagctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
23200635 |
cagctcacagcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
23200698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 26928174 - 26928111
Alignment:
| Q |
881 |
cagctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
26928174 |
cagctcacggcataacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
26928111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 612 - 692
Target Start/End: Complemental strand, 35768085 - 35768007
Alignment:
| Q |
612 |
aatatcaaactttctctattccacgttgattagnnnnnnnnnatcaagacgttgattagttgttatattagcaaaaagatg |
692 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35768085 |
aatatcaaactttctccatcccacgttgattagttttttt--atcaagacggtgattagttgttatattagaaaaaagatg |
35768007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 749 - 785
Target Start/End: Original strand, 46226084 - 46226120
Alignment:
| Q |
749 |
gaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46226084 |
gaacccggaccttgcatatattatgcattgtccctac |
46226120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 752 - 784
Target Start/End: Original strand, 48656909 - 48656941
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctcta |
784 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48656909 |
cccggaccttgcatatattatgcattgtctcta |
48656941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 313 - 376
Target Start/End: Original strand, 23405759 - 23405822
Alignment:
| Q |
313 |
tggtcttccctatgccacccatgccccatatcccaatccttttaacttcttttgatcccatttc |
376 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| ||||||| || ||||| || ||||| |
|
|
| T |
23405759 |
tggtctttcctatgccacccatgccccatattccaatgattttaacatcatttgacccaatttc |
23405822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 780
Target Start/End: Original strand, 48944354 - 48944393
Alignment:
| Q |
741 |
cggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
48944354 |
cggagtttgaaccctgatcttgcatatattatgcattgtc |
48944393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 753 - 783
Target Start/End: Original strand, 46226036 - 46226066
Alignment:
| Q |
753 |
ccggaccttgcatatattatgcattgtctct |
783 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46226036 |
ccggaccttgcatatattatgcattgtctct |
46226066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 785
Target Start/End: Original strand, 47536477 - 47536523
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
47536477 |
ccggagtttgaacctcggaccttgcatattttatgcattgtccctac |
47536523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 748 - 785
Target Start/End: Complemental strand, 4564664 - 4564627
Alignment:
| Q |
748 |
tgaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4564664 |
tgaatccggaccttgcatatattatgcattgtccctac |
4564627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 5186896 - 5186851
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
5186896 |
ccggggtttgaacccagaccttgcatatattaagcattgtccctac |
5186851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 742 - 782
Target Start/End: Original strand, 7626460 - 7626501
Alignment:
| Q |
742 |
ggagtttgaaccc-ggaccttgcatatattatgcattgtctc |
782 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7626460 |
ggagtttgaaccccggaccttgcatattttatgcattgtctc |
7626501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 784
Target Start/End: Complemental strand, 8075849 - 8075804
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtctcta |
784 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8075849 |
ccggggtttgaacctcagaccttgcatatattatgcattgtctcta |
8075804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 8238628 - 8238587
Alignment:
| Q |
740 |
ccggagtttgaacccg-gaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8238628 |
ccggagtttgaaccccagaccttgcatatattatgcattgtc |
8238587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 34899148 - 34899115
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
34899148 |
cccggaccttgcatatattatgcattgtccctac |
34899115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 38130956 - 38130997
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38130956 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
38130997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 781
Target Start/End: Original strand, 40575619 - 40575648
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40575619 |
cccggaccttgcatatattatgcattgtct |
40575648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 45431999 - 45431966
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
45431999 |
cccggaccttgcatatattatgcattgtccctac |
45431966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 46903972 - 46903931
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
46903972 |
ccggagtttgaaccctggaccttacatatattatgcattgtc |
46903931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Original strand, 48022312 - 48022357
Alignment:
| Q |
741 |
cggagtttgaacccggacctt-gcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
48022312 |
cggagtttgaaccccgaactttgcatatattatgcattgtctctac |
48022357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 48511301 - 48511268
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
48511301 |
cccggaccttgcatatattatgcattgtccctac |
48511268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 48849760 - 48849801
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48849760 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 742 - 771
Target Start/End: Original strand, 53377172 - 53377201
Alignment:
| Q |
742 |
ggagtttgaacccggaccttgcatatatta |
771 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53377172 |
ggagtttgaacccggaccttgcatatatta |
53377201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 15)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 737 - 780
Target Start/End: Original strand, 26320558 - 26320601
Alignment:
| Q |
737 |
tgaccggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26320558 |
tgaccggagtttgaacccggaccttgcatattttatgcattgtc |
26320601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 746 - 780
Target Start/End: Complemental strand, 18256940 - 18256906
Alignment:
| Q |
746 |
tttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18256940 |
tttgaacccggaccttgcatatattatgcattgtc |
18256906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 6097892 - 6097955
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
6097892 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcaggatttccctgttcttc |
6097955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Original strand, 20847514 - 20847549
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20847514 |
gtttgaacccggaccttgcatattttatgcattgtc |
20847549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 4826354 - 4826308
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
4826354 |
ccggagtttgaacctcgaaccttacatatattatgcattgtctctac |
4826308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 792
Target Start/End: Original strand, 28231422 - 28231476
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
28231422 |
ccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgag |
28231476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 781
Target Start/End: Complemental strand, 4450313 - 4450284
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4450313 |
cccggaccttgcatatattatgcattgtct |
4450284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 8569773 - 8569732
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8569773 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
8569732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 745 - 785
Target Start/End: Original strand, 8637439 - 8637480
Alignment:
| Q |
745 |
gtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
8637439 |
gtttgaacctcggaccttgcatatattatgcattgtccctac |
8637480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 756 - 785
Target Start/End: Complemental strand, 12412324 - 12412295
Alignment:
| Q |
756 |
gaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12412324 |
gaccttgcatatattatgcattgtctctac |
12412295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 743 - 780
Target Start/End: Original strand, 21373407 - 21373444
Alignment:
| Q |
743 |
gagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
21373407 |
gagtttgaacctggaccttgcatattttatgcattgtc |
21373444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 756 - 785
Target Start/End: Original strand, 24373724 - 24373753
Alignment:
| Q |
756 |
gaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24373724 |
gaccttgcatatattatgcattgtctctac |
24373753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 26356078 - 26356119
Alignment:
| Q |
740 |
ccggagtttgaacccgga-ccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
26356078 |
ccggagtttgaaccccgaaccttgcatatattatgcattgtc |
26356119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Complemental strand, 29283878 - 29283833
Alignment:
| Q |
741 |
cggagtttgaacccg-gaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29283878 |
cggagtttgaaccctagaccttgcatatattatacattgtctctac |
29283833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 32053852 - 32053811
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
32053852 |
ccggagtttgaaccacgaaccttgcatatattatgcattgtc |
32053811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000006; HSPs: 26)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 737 - 785
Target Start/End: Original strand, 25783443 - 25783492
Alignment:
| Q |
737 |
tgaccggagtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
25783443 |
tgaccggagtttgaaccccggaccttgcatatattatgcattgtccctac |
25783492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 742 - 785
Target Start/End: Original strand, 17423176 - 17423220
Alignment:
| Q |
742 |
ggagtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17423176 |
ggagtttgaaccccggaccttgcatatattatgcattgtctctac |
17423220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 13992785 - 13992848
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
13992785 |
cagctcacgacatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
13992848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 28468071 - 28468008
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
28468071 |
cagctcacggcatcacaaaatcgtgttacgatgccaaattcgtgtcacgatttctctgttcttc |
28468008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 31495808 - 31495871
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
31495808 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttccctgttcttc |
31495871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 737 - 785
Target Start/End: Original strand, 47425523 - 47425571
Alignment:
| Q |
737 |
tgaccggagtttgaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
47425523 |
tgactggagtttgaatccggaccttgcatatattatatattgtctctac |
47425571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Complemental strand, 56205005 - 56204970
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
56205005 |
gtttgaatccggaccttgcatatattatgcattgtc |
56204970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 737 - 780
Target Start/End: Complemental strand, 11692719 - 11692674
Alignment:
| Q |
737 |
tgaccggagtttgaacccg--gaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11692719 |
tgaccggagtttgaacccccagaccttgcatatattatgcattgtc |
11692674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 754 - 792
Target Start/End: Complemental strand, 25978366 - 25978328
Alignment:
| Q |
754 |
cggaccttgcatatattatgcattgtctctacaactgag |
792 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25978366 |
cggaccttgcatatattatgcattgtccttacaactgag |
25978328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 882 - 939
Target Start/End: Complemental strand, 31985220 - 31985159
Alignment:
| Q |
882 |
agctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31985220 |
agctcacggtatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
31985159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 781
Target Start/End: Original strand, 49041978 - 49042020
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49041978 |
ccggggtttgaaccccggaccttgcatatattatgcattgtct |
49042020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 746 - 780
Target Start/End: Original strand, 52375778 - 52375812
Alignment:
| Q |
746 |
tttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52375778 |
tttgaacccagaccttgcatatattatgcattgtc |
52375812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Original strand, 836233 - 836278
Alignment:
| Q |
741 |
cggagtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
836233 |
cggagtttgaacctcggaccttgcatatattttgcattgtccctac |
836278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Original strand, 3346272 - 3346317
Alignment:
| Q |
741 |
cggagtttga-acccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||| |||| |
|
|
| T |
3346272 |
cggagtttgacactcggaccttgcatatattatgcattgtccctac |
3346317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 756 - 785
Target Start/End: Original strand, 11286795 - 11286824
Alignment:
| Q |
756 |
gaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11286795 |
gaccttgcatatattatgcattgtctctac |
11286824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Original strand, 19997362 - 19997407
Alignment:
| Q |
741 |
cggagtttgaacccggacctt-gcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
19997362 |
cggagtttgaaccccgaactttgcatatattatgcattgtctctac |
19997407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Original strand, 20799404 - 20799437
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
20799404 |
cccggaccttgcatatattatgcattgtccctac |
20799437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 756 - 785
Target Start/End: Original strand, 21317352 - 21317381
Alignment:
| Q |
756 |
gaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21317352 |
gaccttgcatatattatgcattgtctctac |
21317381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 744 - 784
Target Start/End: Original strand, 27871379 - 27871420
Alignment:
| Q |
744 |
agtttgaacc-cggaccttgcatatattatgcattgtctcta |
784 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27871379 |
agtttgaacctcggaccttgcatatattatacattgtctcta |
27871420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 781
Target Start/End: Original strand, 34834016 - 34834045
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34834016 |
cccggaccttgcatatattatgcattgtct |
34834045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 37921810 - 37921769
Alignment:
| Q |
740 |
ccggagtttgaa-cccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37921810 |
ccggggtttgaatcccggaccttgcatatattatgcattgtc |
37921769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Complemental strand, 41521017 - 41520972
Alignment:
| Q |
741 |
cggagtttgaacccgga-ccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
41521017 |
cggagtttgaaccttgaaccttgcatatattatgcattgtctctac |
41520972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 744 - 780
Target Start/End: Original strand, 49953404 - 49953441
Alignment:
| Q |
744 |
agtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49953404 |
agtttgaaccccggaccttgcatatattatgcattgtc |
49953441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 745 - 785
Target Start/End: Original strand, 50362141 - 50362182
Alignment:
| Q |
745 |
gtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
50362141 |
gtttgaaccctggaccttgcatatattatgcattgtccctac |
50362182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 54500620 - 54500587
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
54500620 |
cccggaccttacatatattatgcattgtctctac |
54500587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 56551589 - 56551630
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
56551589 |
ccggggtttgaacctcggaccttgcatatattatgcattgtc |
56551630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0491
Description:
Target: scaffold0491; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 9214 - 9277
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
9214 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
9277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 11659 - 11722
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
11659 |
cagctcacggcatcatgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
11722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 17525 - 17462
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
17525 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
17462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 19)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 743 - 779
Target Start/End: Original strand, 40919360 - 40919396
Alignment:
| Q |
743 |
gagtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40919360 |
gagtttgaacccggaccttgcatatattatgcattgt |
40919396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 746 - 780
Target Start/End: Original strand, 7968944 - 7968978
Alignment:
| Q |
746 |
tttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7968944 |
tttgaacccggaccttgcatatattatgcattgtc |
7968978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 745 - 779
Target Start/End: Original strand, 44084274 - 44084308
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44084274 |
gtttgaacccggaccttgcatatattatgcattgt |
44084308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 740 - 781
Target Start/End: Complemental strand, 13286194 - 13286153
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13286194 |
ccggggtttgaacccggatcttgcatatattatgcattgtct |
13286153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 26288423 - 26288486
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
26288423 |
cagctcacggcatcacaaaatcatgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
26288486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 26301680 - 26301743
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
26301680 |
cagctcacggcatcacaaaatcatgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
26301743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 26313674 - 26313737
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
26313674 |
cagctcacggcatcacaaaatcatgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
26313737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 741 - 780
Target Start/End: Original strand, 27718892 - 27718932
Alignment:
| Q |
741 |
cggagtttgaac-ccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27718892 |
cggagtttgaactccggaccttgcatatattatgcattgtc |
27718932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 43240397 - 43240357
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
43240397 |
ccggagttcgaacccggatcttgcatatattatgcattgtc |
43240357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 780
Target Start/End: Original strand, 7987728 - 7987767
Alignment:
| Q |
741 |
cggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
7987728 |
cggaatttgaacccggaccttgcatatattatgtattgtc |
7987767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 780
Target Start/End: Complemental strand, 8837982 - 8837943
Alignment:
| Q |
741 |
cggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8837982 |
cggaatttgaacccggaccttgtatatattatgcattgtc |
8837943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Complemental strand, 30427789 - 30427754
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30427789 |
gtttgaacctggaccttgcatatattatgcattgtc |
30427754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 783
Target Start/End: Complemental strand, 44794952 - 44794913
Alignment:
| Q |
745 |
gtttgaac-ccggaccttgcatatattatgcattgtctct |
783 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44794952 |
gtttgaactccggaccttgcatatattatgcattgtctct |
44794913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 7553743 - 7553697
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7553743 |
ccggagtttgaaccttggaccttgcatatattatgcattgtccctac |
7553697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 8881339 - 8881293
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
8881339 |
ccggggtttgaaccctggaccttgcatatattatgcattgtccctac |
8881293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 12748965 - 12748924
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12748965 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
12748924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 32051529 - 32051570
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32051529 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
32051570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 785
Target Start/End: Complemental strand, 33996132 - 33996087
Alignment:
| Q |
741 |
cggagtttgaacccggacctt-gcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
33996132 |
cggagtttgaaccccgaactttgcatatattatgcattgtctctac |
33996087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 37141421 - 37141380
Alignment:
| Q |
740 |
ccggagtttgaacccgga-ccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
37141421 |
ccggagtttgaaccccgaaccttgcatatattatgcattgtc |
37141380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000002; HSPs: 19)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 39731027 - 39730964
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
39731027 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
39730964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 881 - 939
Target Start/End: Complemental strand, 48408492 - 48408430
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
48408492 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
48408430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 741 - 786
Target Start/End: Complemental strand, 18023742 - 18023696
Alignment:
| Q |
741 |
cggagtttgaaccc-ggaccttgcatatattatgcattgtctctaca |
786 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
18023742 |
cggagtttgaaccctggaccttgcatatattatgcattgtccctaca |
18023696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 21646549 - 21646612
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
21646549 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaatttgtgtcacgatttctctgttcttc |
21646612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 43504627 - 43504690
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
43504627 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttccctgttcttc |
43504690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 741 - 780
Target Start/End: Original strand, 47342432 - 47342472
Alignment:
| Q |
741 |
cggagtttgaac-ccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47342432 |
cggagtttgaactccggaccttgcatatattatgcattgtc |
47342472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 787
Target Start/End: Complemental strand, 3830127 - 3830084
Alignment:
| Q |
745 |
gtttgaaccc-ggaccttgcatatattatgcattgtctctacaa |
787 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
3830127 |
gtttgaaccctggaccttgcatatattatgcattgtccctacaa |
3830084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Complemental strand, 3953499 - 3953464
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3953499 |
gtttgaacccgaaccttgcatatattatgcattgtc |
3953464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 882 - 940
Target Start/End: Original strand, 2058513 - 2058574
Alignment:
| Q |
882 |
agctcacggcatcacaaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
||||||||||| | |||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
2058513 |
agctcacggcacctcaaatcgtgtcacgatgccaaaatcgtgtcacgatttctctgttcttc |
2058574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 745 - 779
Target Start/End: Complemental strand, 10327012 - 10326978
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10327012 |
gtttgaacctggaccttgcatatattatgcattgt |
10326978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 737 - 779
Target Start/End: Original strand, 24027054 - 24027096
Alignment:
| Q |
737 |
tgaccggagtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24027054 |
tgaccggggtttgaaccccgaccttgcatattttatgcattgt |
24027096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 792
Target Start/End: Original strand, 42829231 - 42829285
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| ||| |||||||| |
|
|
| T |
42829231 |
ccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactgag |
42829285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 745 - 779
Target Start/End: Complemental strand, 45088934 - 45088900
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
45088934 |
gtttgaaccccgaccttgcatatattatgcattgt |
45088900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 19626522 - 19626563
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19626522 |
ccggtgtttgaaccccggaccttgcatatattatgcattgtc |
19626563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 781
Target Start/End: Original strand, 20085769 - 20085798
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20085769 |
cccggaccttgcatatattatgcattgtct |
20085798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 744 - 785
Target Start/End: Original strand, 25128949 - 25128990
Alignment:
| Q |
744 |
agtttgaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
25128949 |
agtttgaacccgaaccttgcatatattatacattgtccctac |
25128990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 27462433 - 27462474
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27462433 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
27462474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 743 - 779
Target Start/End: Original strand, 39280818 - 39280855
Alignment:
| Q |
743 |
gagtttgaaccc-ggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39280818 |
gagtttgaaccccggaccttgcatatattatgcattgt |
39280855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 46737849 - 46737808
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46737849 |
ccggtgtttgaaccccggaccttgcatatattatgcattgtc |
46737808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000002; HSPs: 16)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 32289242 - 32289179
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
32289242 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
32289179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 26999174 - 26999128
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
26999174 |
ccggagtttgaaccgcagaccttgcatatattatgcattgtctctac |
26999128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 884 - 940
Target Start/End: Original strand, 25410175 - 25410235
Alignment:
| Q |
884 |
ctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
25410175 |
ctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
25410235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 734 - 785
Target Start/End: Complemental strand, 7206195 - 7206143
Alignment:
| Q |
734 |
tgttgaccggagtttgaacc-cggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||| |||| |||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7206195 |
tgttggccggggtttaaacctcggaccttgcatatattatgcattgtctctac |
7206143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 744 - 780
Target Start/End: Complemental strand, 12353715 - 12353679
Alignment:
| Q |
744 |
agtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12353715 |
agtttgaacccggaccctgcatatattatgcattgtc |
12353679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 881 - 939
Target Start/End: Original strand, 3492283 - 3492345
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
3492283 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacaatttctctgttctt |
3492345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 882 - 940
Target Start/End: Original strand, 4484830 - 4484892
Alignment:
| Q |
882 |
agctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
4484830 |
agctcacggcatcatgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
4484892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Original strand, 9581289 - 9581324
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9581289 |
gtttgaacccggaccttgcatatattattcattgtc |
9581324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 779
Target Start/End: Complemental strand, 32458365 - 32458326
Alignment:
| Q |
741 |
cggagtttgaaccc-ggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32458365 |
cggagtttgaaccctggaccttgcatatattatgcattgt |
32458326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 743 - 780
Target Start/End: Original strand, 24579668 - 24579706
Alignment:
| Q |
743 |
gagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24579668 |
gagtttgaaccctggaccttgcatatattatgcattgtc |
24579706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 29544691 - 29544645
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
29544691 |
ccggggtttgaaccccggaccttgcatatattatgcattgtccctac |
29544645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Original strand, 20565085 - 20565118
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
20565085 |
cccggaccttgcatatattatgcattgtccctac |
20565118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Original strand, 31815897 - 31815930
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
31815897 |
cccggaccttgcatatattatgcattgtccctac |
31815930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 883 - 940
Target Start/End: Original strand, 32247262 - 32247322
Alignment:
| Q |
883 |
gctcacggcatcacaaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||| |||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
32247262 |
gctcacggcatctcaaatcgtgtcacgattccaaaatcgtgtcacgatttctctgttcttc |
32247322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 33064050 - 33064009
Alignment:
| Q |
740 |
ccggagtttgaac-ccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
33064050 |
ccggagttcgaactccggaccttgcatatattatgcattgtc |
33064009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 42791359 - 42791318
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42791359 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
42791318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 22)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 24202345 - 24202282
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24202345 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttcttc |
24202282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 881 - 939
Target Start/End: Complemental strand, 19365862 - 19365800
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
19365862 |
cagctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
19365800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 745 - 787
Target Start/End: Original strand, 21184051 - 21184093
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtctctacaa |
787 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
21184051 |
gtttgaacccggacattgcatatattatgtattgtctctacaa |
21184093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 881 - 939
Target Start/End: Complemental strand, 19361006 - 19360944
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
19361006 |
cagctcacggcatcacaaaatcgtgtcacgataccaaattcgtgtcacgatttctctgttctt |
19360944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Original strand, 30548094 - 30548129
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30548094 |
gtttgaacccgaaccttgcatatattatgcattgtc |
30548129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 792
Target Start/End: Original strand, 16033447 - 16033501
Alignment:
| Q |
740 |
ccggagtttgaacccg-gaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
16033447 |
ccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
16033501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 745 - 779
Target Start/End: Original strand, 27023658 - 27023692
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27023658 |
gtttgaacccgaaccttgcatatattatgcattgt |
27023692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 5907863 - 5907822
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5907863 |
ccggggtttgaaccctggaccttgcatatattatgcattgtc |
5907822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 6000140 - 6000181
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6000140 |
ccggggtttgaacctcggaccttgcatatattatgcattgtc |
6000181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 745 - 781
Target Start/End: Original strand, 10654449 - 10654486
Alignment:
| Q |
745 |
gtttgaacc-cggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10654449 |
gtttgaaccacggaccttgcatatattatgcattgtct |
10654486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 16967191 - 16967232
Alignment:
| Q |
740 |
ccggagtttgaacc-cggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16967191 |
ccggagtttgaacctcgaaccttgcatatattatgcattgtc |
16967232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 25533037 - 25532996
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25533037 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
25532996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 32864343 - 32864310
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
32864343 |
cccggactttgcatatattatgcattgtctctac |
32864310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Original strand, 36371050 - 36371083
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
36371050 |
cccggaccttacatatattatgcattgtctctac |
36371083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 883 - 940
Target Start/End: Original strand, 39445992 - 39446052
Alignment:
| Q |
883 |
gctcacggcatcacaaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||| |||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
39445992 |
gctcacggcatctcaaatcgtgtcacgattccaaaatcgtgtcacgatttctctgttcttc |
39446052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 756 - 792
Target Start/End: Original strand, 41142700 - 41142737
Alignment:
| Q |
756 |
gaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41142700 |
gaccttgcatatattatgcattgtctctatcaactgag |
41142737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 883 - 940
Target Start/End: Original strand, 41391095 - 41391155
Alignment:
| Q |
883 |
gctcacggcatcacaaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||| |||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
41391095 |
gctcacggcatctcaaatcgtgtcacgattccaaaatcgtgtcacgatttctctgttcttc |
41391155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 41973306 - 41973273
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
41973306 |
cccggaccttgcatatattatgcattgtccctac |
41973273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 737 - 782
Target Start/End: Original strand, 42175444 - 42175489
Alignment:
| Q |
737 |
tgaccggagtttgaacccggaccttgcatatattatgcattgtctc |
782 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
42175444 |
tgaccgggatttgaacccggatcttgcatatattatacattgtctc |
42175489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 45481557 - 45481516
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
45481557 |
ccggagttcgaaccccggaccttgcatatattatgcattgtc |
45481516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 746 - 779
Target Start/End: Complemental strand, 47835864 - 47835831
Alignment:
| Q |
746 |
tttgaacccggaccttgcatatattatgcattgt |
779 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
47835864 |
tttgaacccggaccttgcatattttatgcattgt |
47835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 754 - 783
Target Start/End: Original strand, 47961301 - 47961330
Alignment:
| Q |
754 |
cggaccttgcatatattatgcattgtctct |
783 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47961301 |
cggaccttgcatatattatgcattgtctct |
47961330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000009; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 741 - 780
Target Start/End: Complemental strand, 20125088 - 20125049
Alignment:
| Q |
741 |
cggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20125088 |
cggagtttgaacccgaaccttgcatatattatgcattgtc |
20125049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 740 - 785
Target Start/End: Complemental strand, 11720957 - 11720912
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11720957 |
ccggggtttgaaccccgaccttgcatatattatgcattgtccctac |
11720912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Original strand, 9789715 - 9789778
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
9789715 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttccctgttcttc |
9789778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 16407735 - 16407672
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatg--caattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
16407735 |
cagctcacggcatcacaaaatcgtgtcacgatgtcaaattcgtgtcacgatttctctgttcttc |
16407672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 21316945 - 21316905
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21316945 |
ccggggtttgaacccggacctttcatatattatgcattgtc |
21316905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 881 - 940
Target Start/End: Complemental strand, 26177560 - 26177497
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
26177560 |
cagctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttccctgttcttc |
26177497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 740 - 780
Target Start/End: Complemental strand, 35413020 - 35412980
Alignment:
| Q |
740 |
ccggagtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35413020 |
ccggggttcgaacccggaccttgcatatattatgcattgtc |
35412980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 741 - 784
Target Start/End: Original strand, 35493971 - 35494015
Alignment:
| Q |
741 |
cggagtttgaa-cccggaccttgcatatattatgcattgtctcta |
784 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35493971 |
cggagtttgaatcccgaaccttgcatatattatgcattgtctcta |
35494015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 881 - 939
Target Start/End: Original strand, 15465031 - 15465093
Alignment:
| Q |
881 |
cagctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
15465031 |
cagctcacggcatcacaaaatcgtgtcacgataccaaattcgtgtcacgatttctctgttctt |
15465093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 881 - 939
Target Start/End: Complemental strand, 16409171 - 16409109
Alignment:
| Q |
881 |
cagctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
16409171 |
cagctcacgacatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
16409109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 749 - 780
Target Start/End: Complemental strand, 39914955 - 39914924
Alignment:
| Q |
749 |
gaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39914955 |
gaacccggaccttgcatatattatgcattgtc |
39914924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Original strand, 41650942 - 41650977
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41650942 |
gtttgaactcggaccttgcatatattatgcattgtc |
41650977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 746 - 781
Target Start/End: Original strand, 43135197 - 43135232
Alignment:
| Q |
746 |
tttgaacccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43135197 |
tttgaacccggaccttacatatattatgcattgtct |
43135232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 743 - 780
Target Start/End: Complemental strand, 20688101 - 20688063
Alignment:
| Q |
743 |
gagtttgaac-ccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20688101 |
gagtttgaactccggaccttgcatatattatgcattgtc |
20688063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 883 - 940
Target Start/End: Original strand, 15045189 - 15045249
Alignment:
| Q |
883 |
gctcacggcatcacaaatcgtgtcacgatgc--aattcgtgtca-gatttctctgttcttc |
940 |
Q |
| |
|
|||||||||||| |||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
15045189 |
gctcacggcatctcaaatcgtgtcacgattccaaaatcgtgtcacgatttctctgttcttc |
15045249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 22522798 - 22522839
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22522798 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
22522839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 785
Target Start/End: Complemental strand, 30329153 - 30329120
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtctctac |
785 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
30329153 |
cccggaccttgcgtatattatgcattgtctctac |
30329120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 740 - 780
Target Start/End: Original strand, 40715946 - 40715987
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40715946 |
ccggggtttgaaccccggaccttgcatatattatgcattgtc |
40715987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 884 - 939
Target Start/End: Complemental strand, 8002 - 7943
Alignment:
| Q |
884 |
ctcacggcatcacaaa-tcgtgtcacgatgc--aattcgtgtca-gatttctctgttctt |
939 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
8002 |
ctcacggcatcacaaaatcgtgtcacgatgccaaattcgtgtcacgatttctctgttctt |
7943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 741 - 780
Target Start/End: Original strand, 72773 - 72813
Alignment:
| Q |
741 |
cggagtttgaaccc-ggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
72773 |
cggagtttgaaccctggaccttgcatatattatgcattgtc |
72813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 745 - 780
Target Start/End: Complemental strand, 17790 - 17755
Alignment:
| Q |
745 |
gtttgaacccggaccttgcatatattatgcattgtc |
780 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17790 |
gtttgaacccggaccttgcatgtattatgcattgtc |
17755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 740 - 792
Target Start/End: Original strand, 31919 - 31973
Alignment:
| Q |
740 |
ccggagtttgaaccc-ggaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
31919 |
ccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgag |
31973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 752 - 781
Target Start/End: Complemental strand, 1082 - 1053
Alignment:
| Q |
752 |
cccggaccttgcatatattatgcattgtct |
781 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1082 |
cccggaccttgcatatattatgcattgtct |
1053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 882 - 934
Target Start/End: Complemental strand, 575 - 519
Alignment:
| Q |
882 |
agctcacggcatcac-aaatcgtgtcacgatgc--aattcgtgtca-gatttctctg |
934 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
575 |
agctcacggcatcacgaaatcgtgtcacgatgccaaattcgtgtcacgatttctctg |
519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 741 - 792
Target Start/End: Complemental strand, 99100 - 99047
Alignment:
| Q |
741 |
cggagtttgaacccg-gaccttgcatatattatgcattgtctcta-caactgag |
792 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
99100 |
cggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgag |
99047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University