View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404-Insertion-7 (Length: 266)
Name: NF5404-Insertion-7
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 266
Target Start/End: Complemental strand, 11001049 - 11000791
Alignment:
| Q |
8 |
cacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgtcagatttcaagtccctgtgaatcaaccctaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11001049 |
cacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgtcagatttcaagtccctgtgaatcaaccctaga |
11000950 |
T |
|
| Q |
108 |
ccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgctcggttttgacgctggtttaagaactgtcgaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11000949 |
ccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgctcggttttgacgttggtttaagaactgtcgaa |
11000850 |
T |
|
| Q |
208 |
ctgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgca |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000849 |
ctgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgca |
11000791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 266
Target Start/End: Original strand, 42403553 - 42403811
Alignment:
| Q |
8 |
cacctcaatccgagccactccaaagtcagcaattttgattgacttgtcaccaaaaatcaataggttgtcagatttcaagtccctgtgaatcaaccctaga |
107 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| || ||| |
|
|
| T |
42403553 |
cacctcaatccgagctactccaaagtcggcaattttgattgacttgtcaccaaaaatcaaaaggttgtcggatttcaagtccctgtggatcaatcccaga |
42403652 |
T |
|
| Q |
108 |
ccatgaacataagccatgcctcttgcaacatccaaagcttgtttgacagcttgtttaaggggaactgctcggttttgacgctggtttaagaactgtcgaa |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |||| | |||||||||| |||| |
|
|
| T |
42403653 |
ccatgaacatatgccatgcctcttgcaacatccaaagcttgtttgacagctagtttgaggggaactgatcggttttggcgcttggttaagaactgccgaa |
42403752 |
T |
|
| Q |
208 |
ctgatccacccttagcatactcagtaacgatgcaccagaccataggtttacggcatgca |
266 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
42403753 |
cagatccacccttagcatactcagtaacaatgcaccacaccataggtttacggcatgca |
42403811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University